SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08296
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.198
 

Sequence

CDS
ATGGAGTCCACGATCGATCTGTTCGCGGAATTCCTCCGTCTGAGGTACCCGACATTATCGGCCGAATTTTTAGAATTTAAGGCCAATCACGCCGCGAACTCAGAAGCGGTCTCCGTCGCGCCCGCCGCTCCCGTGTCCCCAATACTCGCGAGCAAAGCTCCCGCGTCGATCGCTGCGGTCTCGGTTCCAGCCCTGCGCTCATCCGCAGCACACGTCGCGTCCACGCGTTCATCCGCGGCCTCCATCGCGCCCGCGCCGTCCTCTGCCCCCGAGCGATTGTCCGTGGCCTCCGTCGCGACCGTCAACCCCGCGCCCTCTAAAACGCCCGCCTGCGGGTCGCCCGCGCCCTCCTCTTCATCCGACTCGGAGTCGGACATGGAGGTCGATCTTTCCCCCGCCCCCTCGACTGATGGATTCACAGTAGTCCAAAAAGGTAAGAGGCGCGCTGCGGAAGCCCGAGCTCCCGCGGCCGCCAAAGAGGAGCGCGAACTTCGTGCCGTCATACGTGGCATCCCTAAAGAGTTGGATGCCGAACTCGTCAAGGCCGACCTTCTGGAACAAGGCCTACCAGTAAATTCAGTGCACCGCATGCACACCGGCCGCGGTAGGGAGCCATATAATATGGTTCTAGTCGCCCTCCAGCCTACCCCCGAGGGTGACGCCATCCGCGCCGCCTCCACTGCACAGCACTTCATCGCCGTTGTGCAAGAATACGCCGACGTATACGCGTCGTTAAATACTGATATCGAGGCGCTGCTCAGCATGGGAAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAATTCTCACACCACAACCCCTAATGGCAGGCGGCTCGACGCGCTAGTTGATGATCTCGCCTTCGATATCATCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAGCTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCGTCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAGCCCGGACTCTACCCCGTCTCTTCAGGATACCGCTGAAGCCATAGACATCCTAACGTCACACATTACCTCGACATTAGATAGGTCATCGAAGCAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCGAATTGCCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCTTCGATCCGCGCCTACGATAGGTATCCTACCATGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGATGTAAAGTCTCGCATCGCCGAAATCCGAGATGCTAGGTGGTCTGATTTCTTAGAAGGACTCGCGCCCTCTCAAAGGTCTTACTACCGTTTAGCTCGTACTCTCAAATCGGATACGGTTGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGTCGACTCGCGGCGTTTGATGATGACGAAAAAGCAGAGCCGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCATTCAATCCGCGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCGGATGCGTTACCACCCGTCACCCCAATGGAAGTTAAAGACCTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCATCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCAGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGTTACCGCCCGATTAGCCTCCTCATGTCTCTGGGCAAACTGTATGAGCGTTTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCAAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTGCAAATCACTCATGCGTACAACAGGTGCACCGCCTCACGGAGCACATTCTTGTAGGACTTAACCGACCAAAACCGATCTATACGGGAGCCCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTTTTCAACATGGGCGTACCGGATAGTCTCGTGCTCATCATACGAGACTTCTTGTCTAACCGCTCTTTTCGATATCGAGTAGAGGGAACCCGCTCCTCCCCGCGACCACTCACGGCTGGAGTCCCGCAAGGCTCCGTTCTCTCTCCGCTCCTATTTAGTTTATTTATTAACGATATTCCCCGGTCGCCGCCGACTCAGCTAGCCTTATTCGCTGACGACACAACCGTTTACTACTCAAGTAGAAACAAGTCCCTAATCGCGAGTAAGCTCCAGAGTGCAGCGTTAACCCTCGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGCACAGCAGTGTTATTTCAAAGGGGAAACTCACCGCTTATTTCCTCCCGCATTAGGAGGAGAAATATCACACCCCCGATCACCCTCTTCGGCCAACCTATACCCTGGGCTAGGAAGGTCAAGTACCTGGGAGTCACCCTGGATGCATCCATGACATTCCGCCCGCATATAAAAACAGTCCGCGATCGTGCCGCATTTATTCTCGGCAGACTCTATCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCCGTCGGGGCTCCGTGGTTCGTGAGGAACGTCGACCTACACGACGACCTGGGCCTCGAATCGATCCGCAAACACATGAAGTCAGTGTCGGAACGTTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCTGCCGCTGACTATTCCCCGAATCCTGATCACGCAGGAGCAAGTCACCGTCGTCGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACTCTTGCATTAGATACCTTCAGCTCTAACACTAGGAGCAGGCTGAGGAACCCCGGTAACCGTACGCGTCGAACTCGACAAAGAGGTCGACGTGCAGCCTAA
Protein
MESTIDLFAEFLRLRYPTLSAEFLEFKANHAANSEAVSVAPAAPVSPILASKAPASIAAVSVPALRSSAAHVASTRSSAASIAPAPSSAPERLSVASVATVNPAPSKTPACGSPAPSSSSDSESDMEVDLSPAPSTDGFTVVQKGKRRAAEARAPAAAKEERELRAVIRGIPKELDAELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQPTPEGDAIRAASTAQHFIAVVQEYADVYASLNTDIEALLSMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIIAPLTPTHYPLNIAHRPDILDIALLKNVALRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGVSLAESDPPSLPFSPDSTPSLQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFELPDDIRELLRAKNASIRAYDRYPTMENRIRMRALQRDVKSRIAEIRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAEPLADTLQTQCTPSIQSADPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPIQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRANHSCVQQVHRLTEHILVGLNRPKPIYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFINDIPRSPPTQLALFADDTTVYYSSRNKSLIASKLQSAALTLGQWFRKWRIDINPAKSTAVLFQRGNSPLISSRIRRRNITPPITLFGQPIPWARKVKYLGVTLDASMTFRPHIKTVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKHMKSVSERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITLALDTFSSNTRSRLRNPGNRTRRTRQRGRRAA

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
AB018558    BAA76304.1    U07847    AAA17752.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    GALX01005299    JAB63167.1    KQ973342    KXZ75569.1    GALX01005359    JAB63107.1    ABLF02042518    ABLF02057746    GBBI01004395    JAC14317.1    GGMR01018716    MBY31335.1    GGMS01006359    MBY75562.1    GFTR01008038    JAW08388.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02034467    ABLF02008153    ABLF02008462    ABLF02008464    GBBI01004571    JAC14141.1    GFTR01008262    JAW08164.1    NEVH01022639    PNF18527.1    GEZM01053022    JAV74219.1    ABLF02024246    NEVH01006736    PNF36716.1    GGFL01004957    MBW69135.1    GGMS01002992    MBY72195.1    GFTR01008279    JAW08147.1    ABLF02023911    GGFL01005012    MBW69190.1    ABLF02041767    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    NEVH01011985    PNF31054.1    GGMR01003407    MBY16026.1    NEVH01021205    PNF19912.1    NEVH01027074    PNF13841.1    GFTR01008256    JAW08170.1    NEVH01009134    PNF33528.1    S59870    AAB26437.2    GGFJ01002256    MBW51397.1    GEZM01084969    JAV60363.1    RPOV01000134    RPJ78669.1    GGFJ01001822    MBW50963.1    GGFJ01002257    MBW51398.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GFTR01008271    JAW08155.1    GFTR01008251    JAW08175.1    GGFJ01001842    MBW50983.1    GGFJ01001844    MBW50985.1    GGFJ01001843    MBW50984.1    GGMR01000676    MBY13295.1    GGFJ01001858    MBW50999.1    NEVH01020940    PNF20481.1    GGFJ01001857    MBW50998.1    AY060438    AAL25477.1    GFTR01008261    JAW08165.1    NEVH01026386    PNF14434.1    GBBI01003810    JAC14902.1    NWSH01000032    PCG80496.1    GFTR01008246    JAW08180.1    GGMR01003864    MBY16483.1    GFTR01008257    JAW08169.1    GGMS01017365    MBY86568.1    GEDC01000337    JAS36961.1    NEVH01017470    PNF24199.1    NEVH01016302    PNF25823.1    KU543685    AMS38375.1    GFTR01008151    JAW08275.1    GGMR01000226    MBY12845.1    KK119692    KFM76444.1    AF456125    AAL57609.1    AY180919    AAN87272.1    GBGD01000415    JAC88474.1    GFXV01000908    MBW12713.1    GFTR01008260    JAW08166.1    ABLF02014118    ABLF02014121    ABLF02054790    NEVH01014858    PNF27387.1    NEVH01007838    PNF34986.1    DNOY01000259    HBE18313.1    NEVH01002716    PNF41415.1    GGMR01012443    MBY25062.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.0250228,     Score=92

Ontologies

Topology

Length:
1080
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.88307
Exp number, first 60 AAs:
0.00119
Total prob of N-in:
0.00040
outside
1  -  1080
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
142.285328
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号