SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08268
Annotation
reverse_transcriptase?_partial_[Trilocha_sp._GAS-2011]
Location in the cell
Nuclear   Reliability : 1.367
 

Sequence

CDS
ATGGCCCCCCCGGTCACGGAGCGTCTCCAGCCTAAGCAGCTGCGGGACATCGTCTCAGCGCTGTTCCCGCAAGAGCGGGAGGGATTTGTCGCTCCCGCTATGGACGCGCCGCCGGACTACGACGACGAAGCCCCTGCTGAGGTGCCTCATATAACGGGGGCGGAGCTCCGTGTGGCCGTGCGCGAAGGACACTGCACCCGGCCCAAACGGTGTCCATGGCCGGTTTGGGCCTTGGCTTTTGCTGCTCTAGGGGACCGACTCTTGAGACTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGTCCGGCGGATACTGGCGCCGGGTACCATCCTATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACACATTCTGGCAGCCCGCATCATCCAGCATATGGTCAGGGTGGGACCCGATCTGTCGCCGGAGCATTATGGCTTCCGAGAGAGCCGCTCAACGATAGACGCGATCCTTCGGGTGCGGGCCCTCTCGGAGGCCGTTTCCAGGGGTGGGGTGGCTTTGGCGGTGTCGCAAGCCCTGGCCCTCTAA
Protein
MAPPVTERLQPKQLRDIVSALFPQEREGFVAPAMDAPPDYDDEAPAEVPHITGAELRVAVREGHCTRPKRCPWPVWALAFAALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTGAGYHPIVLLDEVGKLLEHILAARIIQHMVRVGPDLSPEHYGFRESRSTIDAILRVRALSEAVSRGGVALAVSQALAL

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF00098   zf-CCHC
PF01553   Acyltransferase
PF00075   RNase_H
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR012337   RNaseH-like_sf       
IPR002156   RNaseH_domain       
IPR036397   RNaseH_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
199
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01769
Exp number, first 60 AAs:
0
Total prob of N-in:
0.05313
outside
1  -  199
 
 

Population Genetic Test Statistics

Pi
150.268162
Theta
80.868391
Tajima's D
0.787389
CLR
0
CSRT
0.598770061496925
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号