SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08260
Pre Gene Modal
BGIBMGA002329
Annotation
PREDICTED:_uncharacterized_protein_LOC103310341_[Acyrthosiphon_pisum]
Full name
ATP-dependent DNA helicase      
Location in the cell
Extracellular   Reliability : 1.296 Nuclear   Reliability : 1.31
 

Sequence

CDS
ATGCCTAGAGGACGACGGGCGAACATCGGCCGCCGCACAAGACATGCAAGCCAGCAACAAGTGTATTCACAGAACTTAAGCGAAGAAAGACAAAATATAATAAGAGAAAATGCCCGATTGAGACAACGCGTGAGCACACGAAGATCATTGGCATCATACAATCGCTTGGCATTCCAATATGATCCCACTGCGAACTACAGTGATGATGAAAATTTAGATATTGGACCAATGACGACTATATGCCGATATTGCAATGCGTTAAAGTTCAAAAGAGAAACGGCTGGATTGTGCTGCGCAAGTGGAAAAGTCAAACTAGATCCATTACTTACACCACCACAGCCACTGAAACTATTGTTCGATGGAACTGATCCCGATTCCAGCCATTTTCTTCAACACATCCTTGAATACAATAACTGCTTTCGCATGACTTCCTTTGGCGCTAATATCATTCGAGAAGGCGGCTTCATGCCGACTTGCAAGCAATTCGCTGTCGACATGTATGTCAAAGTCGAGACTGAACGTTTAGCGTTCATCCGATTCAATCAGGCAAAGCTACGATCTGAGGACTATATACACTTGCGTGATGCTATTCATTCAGATGGTGATGTTCAAAATATTGGACGTCTGACGATTCTCCCATCATCTTATATCGGAAGCCCACGCCACATGCACGAATACGCTCAAGACGCTATGACGTACGTGCGAAATTATGGAACTCCGGATTTATTTATTACGTTCACATGCAATCCGAAGTGGACGGAAATTGAACCTGAAATTCCTGATCCAGTCACTGATCTCCATCTACACGATATTGTGACAACACAGATGGTGCATGGACCGTGCGGTGCATTAAATCCATTATCGCCTTGCATGGCTGATGGAAAGTGCACAAAACGATATCCGCGACCGTTAGTTGCTGAAACAGTCACAGGGAACGATGGATATCCAGTTTATCGTCGGCGTTCAAAAGAAAATAATGGTCGAACTATCAAAGTTAAAGTTCAAAATCAAGAGATTGAGATCGGAAATGAATTCATTGTACCATATTGCCCGCTGCTATCAAGAATTTTCGAAACACATGCAAACGTTGAGAGTTGTCATTCGGCCAAATCAATCAAATATTTGTGCAAGTACGTCACAAAAGGCAGCGACATGGCTGTGTTTGGTATTGCGTCGGAAAATGCGAATGACGAAATCAGTAACTTCCAAATGGACAGATACGTCAGTACTAATGAAGCACTGTGGCGATTATTGTCATTTCAAATTCATGAAAGATATCCCACAGTTGTACATTTAGCAGTGCATTTGGAAAATGGCCAAAGAGCTTACTTCACTGAGGCTAATGCGGCACAACGAGCTGAAAGACCACCATCGACAACATTGACTAGCTTCTTTGCAATGTGTGAAGCAGATCCATTCGCAGCGACGCTGATGTACGTTGAAATGCCCAAGTATTACACTTGGAATCAATCAACAAAGAAATTCCAACGTCGCAAACAAGGAACCCCAGTTCCAGATTGGCCACAGGTGTTTTCCACTGATGCACTAGGTCGCATGTATACTGTTCATCCTAGAAATGATGAATGTTTTTATTTGCGACTGCTGTTGGTAAATGTACGTGGACCAAAATCATTTGCGCATTTGAAAACTGTGAATGGCCACCAATGCCAAACATATCGAGAAGCATGTCAACTATTGGGTTTGCTGGAGAACGATTCTCATTGGGATTTAACACTTGCGGATTCAGTTGTTTCATCAAATGCGTACCAAATACGAACGCTGTTCGCAATTATCATCACCATATGTTTTCCTTCACAACCAATTCAGTAA
Protein
MPRGRRANIGRRTRHASQQQVYSQNLSEERQNIIRENARLRQRVSTRRSLASYNRLAFQYDPTANYSDDENLDIGPMTTICRYCNALKFKRETAGLCCASGKVKLDPLLTPPQPLKLLFDGTDPDSSHFLQHILEYNNCFRMTSFGANIIREGGFMPTCKQFAVDMYVKVETERLAFIRFNQAKLRSEDYIHLRDAIHSDGDVQNIGRLTILPSSYIGSPRHMHEYAQDAMTYVRNYGTPDLFITFTCNPKWTEIEPEIPDPVTDLHLHDIVTTQMVHGPCGALNPLSPCMADGKCTKRYPRPLVAETVTGNDGYPVYRRRSKENNGRTIKVKVQNQEIEIGNEFIVPYCPLLSRIFETHANVESCHSAKSIKYLCKYVTKGSDMAVFGIASENANDEISNFQMDRYVSTNEALWRLLSFQIHERYPTVVHLAVHLENGQRAYFTEANAAQRAERPPSTTLTSFFAMCEADPFAATLMYVEMPKYYTWNQSTKKFQRRKQGTPVPDWPQVFSTDALGRMYTVHPRNDECFYLRLLLVNVRGPKSFAHLKTVNGHQCQTYREACQLLGLLENDSHWDLTLADSVVSSNAYQIRTLFAIIITICFPSQPIQ

Summary

Catalytic Activity
ATP + H2O = ADP + H(+) + phosphate
Cofactor
Mg(2+)
Similarity
Belongs to the helicase family.
EC Number
3.6.4.12
Pfam
PF14214   Helitron_like_N        + More
PF05970   PIF1
PF02689   Herpes_Helicase
Interpro
IPR010285   DNA_helicase_pif1-like        + More
IPR025476   Helitron_helicase-like       
IPR027417   P-loop_NTPase       
IPR012337   RNaseH-like_sf       
IPR003840   DNA_helicase       
IPR001356   Homeobox_dom       
SUPFAM
SSF52540   SSF52540        + More
SSF53098   SSF53098       

Ontologies

Topology

Subcellular location
Nucleus  
Length:
609
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.11057
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00146
outside
1  -  609
 
 

Population Genetic Test Statistics

Pi
83.263275
Theta
53.005254
Tajima's D
2.155888
CLR
0.177595
CSRT
0.905304734763262
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号