SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08251
Annotation
Yokozuna_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 2.018 Nuclear   Reliability : 1.354
 

Sequence

CDS
ATGACAGCCGAGATGCTTCACACAGACATAGCAGGACCGATTAGACATCAAGGACCTAATGGTGAAAAATATTTTATGACAATTATTGACGATTTCTCTCATTTTTGCGTAGTGTATCCCCTGAAGAGCAAATCTGAAGCAACAGAACGACTGATGAACTATGTATTAAGAATTGAAAACGAAACGGGGAATAAAGTTAAAAGAATTAGATGCGATAATGGTGGAGAGTACACTGCTAATAGTTTGAAACTTTTTTGCATAAATAGAGGTATTAGTTTAGAATACACATTACCGTACACGCCACAACTTAATGGCATATCGGAACGGATGAACCGTACATTATGCGACAAAACAAGGACTCTATTAGCGGAAACCAATTTGCCAAAACATCTGTGGTGCGAAGCGATACAATGTGCAGTTTACCAATTAAACAGATCGCCATCATGGGCCATAAACTTCAAGACACCCAGCGGAATATTTTTTGGTAAAAACGACCTATCGAGATTGAGAGTATTTGGTTCCAAAGCTTGGGCTACTATAGTACCCAAACCAGACAAGTTAGCCAAGAGAGCAAAAGAAACAAGAATGGTAGGTTATGGAACTGTTGGTTACAGATTATGGGATCCAGAAGAAGATAAGATAGTTATTTCCAGAGATGTAAGATTTGATGAAAGCGACATTAAATTCAAAAATAACGAAGAAGTGAAACAAGTAAGATATGTTCAAGACAAAGAAGAAAAAATCAATAAAGAAAAGGAAGATATTGTAGAACAGGAAGATGAATTTAAAGATGCAGAAATGAACACTGATCAAATTGAAGAAGCAATAATCAGACCCAAAAGAACGATAAATCCTCCTGCTTATCTTAAAGATTACGAGACGAATATAGAAAACATAAATGAAACTAATATTGTTATATGTCTGAGTGCAAATGCACCAGAAACTTTCGAAGAAGCTATAAAAGAACCAGAATGGAAAAACGCAATCAATAAAGAGCTAGATGCACTCCAAAGACTACAAACGTGGGAAGAACAAGAAATAACCGATGGAAGAAAGCTCATAGATACAAAATGGATATTTAAACAAAAAGAAGATGGAACAAAAAAGGCAAGACTGGTAGCTAGAGGCTTCCAACAAAAGAAAGAAGATATTTTTGACAGCGTTTATGCACCCGTTGCTAGACATTCAACCATAAGAATGATCTTATCAAAAGCTGTACAAGATGATTTAAAGATTATTCAGCTAGACATTCCCACTGCATTCCTAAATGGAAAATTAAAGTCTGATGTATTTATCAAAATACCCCAAGGATTAGAAATAAAAAATAATAATACAGCATTAAAACTAAAGAGAGCATTGTATGGATTGGTTGAATCACCAAAATGTTGGAATGAAACAATTGACGAATTTGCGAAAGCTAAGGGATTCCAAAGATCAGAATATGATTACTGTTTGTATTACAAAGAAAATTGCTGGATGCTGATTTACGTGGACGATATCCTAATCATTGGAAACGGGGAAGATATAATTAAAGCACTTAAAGAGGAGTTTAACGCAAAATATATGGGCGAAATGAAGAACTTTCTCGGAATGGAAGTTAAAAGAAATAAAGATACATTAGAACTGAAACAAACTAAAATGATTGAAAAGATATTGACTAAATTCAAAATGGATGAATGTAACGGAATTAAAACACACATGGAAAGAAATTACAATATAGAAATAAAGGACAATACAGAAGTTTTGGACGTACCGTATCGAGAACTAATAGGAAGTCTAATTTATCTTACTGTAACAACAAGACCGGATTTAACATTTGCAGTGTCATATCTGAGCAGATTTTTAGATAAACCGAACGAAGAATTATGGAAAGCTGGAAAAAGAGAGGAGTGTTGA
Protein
MTAEMLHTDIAGPIRHQGPNGEKYFMTIIDDFSHFCVVYPLKSKSEATERLMNYVLRIENETGNKVKRIRCDNGGEYTANSLKLFCINRGISLEYTLPYTPQLNGISERMNRTLCDKTRTLLAETNLPKHLWCEAIQCAVYQLNRSPSWAINFKTPSGIFFGKNDLSRLRVFGSKAWATIVPKPDKLAKRAKETRMVGYGTVGYRLWDPEEDKIVISRDVRFDESDIKFKNNEEVKQVRYVQDKEEKINKEKEDIVEQEDEFKDAEMNTDQIEEAIIRPKRTINPPAYLKDYETNIENINETNIVICLSANAPETFEEAIKEPEWKNAINKELDALQRLQTWEEQEITDGRKLIDTKWIFKQKEDGTKKARLVARGFQQKKEDIFDSVYAPVARHSTIRMILSKAVQDDLKIIQLDIPTAFLNGKLKSDVFIKIPQGLEIKNNNTALKLKRALYGLVESPKCWNETIDEFAKAKGFQRSEYDYCLYYKENCWMLIYVDDILIIGNGEDIIKALKEEFNAKYMGEMKNFLGMEVKRNKDTLELKQTKMIEKILTKFKMDECNGIKTHMERNYNIEIKDNTEVLDVPYRELIGSLIYLTVTTRPDLTFAVSYLSRFLDKPNEELWKAGKREEC

Summary

EMBL
AB014676    BAA74713.1    GBHO01027564    JAG16040.1    GBHO01004832    JAG38772.1    + More
GDHC01019310    JAP99318.1    GEDC01012841    GEDC01000503    JAS24457.1    JAS36795.1    GBHO01035173    JAG08431.1    GDHC01007058    JAQ11571.1    GFTR01008662    JAW07764.1    LJIG01022881    KRT78250.1    RSAL01000408    RVE41872.1    GEZM01072005    JAV65635.1    GEZM01028916    JAV86196.1    NEVH01013252    PNF29308.1    GEZM01009498    GEZM01009497    JAV94551.1    GEZM01009496    GEZM01009495    JAV94560.1    GEZM01032204    JAV84770.1    NKQK01000002    PSS35035.1    JXUM01136904    KQ568499    KXJ68982.1    GECZ01025604    JAS44165.1    JXUM01155348    KQ572178    KXJ68066.1    LBMM01012772    KMQ86003.1    GEDC01029908    JAS07390.1    GEHC01000959    JAV46686.1    FJ544853    ACL97384.1    ABLF02041793    KQ483522    KYP47640.1    FJ544854    ACL97385.1    FJ544851    ACL97383.1    KQ483843    KYP40337.1    FJ544856    ACL97386.1    NKQK01000016    PSS08126.1    KQ484038    KYP38095.1    OIVN01001052    SPC89229.1    OIVN01006466    SPD33659.1    FJ544857    ACL97387.1    OIVN01002256    SPD02034.1    OIVN01000189    SPC75922.1    OIVN01004879    SPD19723.1    OIVN01004651    SPD18552.1    OIVN01001308    SPC92446.1    OIVN01001931    SPC99063.1    OIVN01000991    OIVN01001835    SPC88370.1    SPC98114.1    OIVN01002055    SPD00174.1    JN402333    AFB73912.1    KQ484186    KYP36645.1    OIVN01000183    SPC75833.1    EF094939    EF094940    ABO36622.1    ABO36636.1    CM003607    KYP67664.1    KK112142    KFM56833.1    OIVN01002680    SPD05612.1    OIVN01001196    SPC91020.1    KQ483417    KYP53032.1    OIVN01000557    SPC82046.1    OIVN01002904    SPD07378.1    GEZM01098220    JAV53943.1    JN402332    AFB73911.1    OIVN01002516    SPD04274.1    OIVN01000404    SPC79669.1    OIVN01003683    SPD12935.1    KQ483702    KYP42748.1    OIVN01004420    SPD17230.1    OIVN01002854    SPD06945.1    QGNW01001602    RVW35576.1    QGNW01000038    RVX09487.1    GDHC01015473    JAQ03156.1    QGNW01002195    RVW23445.1    QGNW01001808    RVW30183.1    QGNW01000493    RVW69546.1    JXUM01011189    KQ560325    KXJ83029.1    QGNW01000052    RVX06204.1    QGNW01001119    RVW55023.1    AC134048    DP000010    AAX92941.1    ABA91548.1    OIVN01003569    SPD12194.1    SDMP01000010    RYR33127.1    OIVN01004867    SPD19656.1    OIVN01001130    SPC90232.1    CM007892    OTG31811.1    OIVN01006120    SPD25513.1    QGNW01000029    RVX11927.1    QGNW01000255    RVW81243.1    DP000011    ABA98656.1    AC116368    AAX92861.1    ABA92739.1    OIVN01001666    SPC96375.1    OIVN01006261    SPD29147.1    QGNW01000079    RVX00796.1    OIVN01002656    SPD05381.1    OIVN01005059    SPD20680.1    QGNW01000769    RVW62538.1    OIVN01005591    SPD23209.1    AC129717    AAT85194.1    QGNW01000381    RVW73873.1    OIVN01004379    SPD17029.1    ABLF02020302    QGNW01000267    RVW80348.1    QGNW01001457    RVW40577.1    AM489192    CAN71109.1    ASHM01015075    PNX96991.1    CM007893    OTG30017.1    QGNW01000228    RVW83440.1   
Pfam
PF00665   rve        + More
PF07727   RVT_2
PF13976   gag_pre-integrs
PF00098   zf-CCHC
PF13961   DUF4219
PF13358   DDE_3
PF08534   Redoxin
PF00106   adh_short
PF03159   XRN_N
PF17846   XRN_M
PF00626   Gelsolin
PF08033   Sec23_BS
PF16495   SWIRM-assoc_1
Interpro
IPR036397   RNaseH_sf        + More
IPR039537   Retrotran_Ty1/copia-like       
IPR001584   Integrase_cat-core       
IPR013103   RVT_2       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR025724   GAG-pre-integrase_dom       
IPR025314   DUF4219       
IPR038717   Tc1-like_DDE_dom       
IPR036291   NAD(P)-bd_dom_sf       
IPR013740   Redoxin       
IPR020904   Sc_DH/Rdtase_CS       
IPR002347   SDR_fam       
IPR036249   Thioredoxin-like_sf       
IPR037944   PRX5-like       
IPR004859   Put_53exo       
IPR041412   Xrn1_helical       
IPR027073   5_3_exoribonuclease       
IPR007123   Gelsolin-like_dom       
IPR029006   ADF-H/Gelsolin-like_dom_sf       
IPR036180   Gelsolin-like_dom_sf       
IPR012990   Sec23_24_beta_S       
IPR032451   SMARCC_C       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF51735   SSF51735       
SSF52833   SSF52833       
SSF82754   SSF82754       
Gene 3D
PDB
3DLR     E-value=1.31631e-06,     Score=127

Ontologies

Topology

Length:
631
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01454
Exp number, first 60 AAs:
0.00077
Total prob of N-in:
0.00057
outside
1  -  631
 
 

Population Genetic Test Statistics

Pi
197.94814
Theta
192.785606
Tajima's D
-0.683659
CLR
206.615273
CSRT
0.196390180490975
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号