SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08209
Annotation
PREDICTED:_uncharacterized_protein_LOC105841331_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.807
 

Sequence

CDS
ATGAAGACAGTCAAGCGTCTCGCCCGCGATGAAACTGATTTCCCGATCGCTTCAGAAATCACTAGTGATCATCTTTATATGGATGATCTAGGAGTTTCGGTAGATACGCCCGAGAATGGAATTCAGTTGGCTCATGATTTAATCGAACTATTCAAACGTGGTGGTTTCGACTTAGTTAAATTCGTTAGCAACTCGCCCGAGGTGTTAAAATCGATTCCGCAAGCCAACCGCTTATCTTCAAAAATTGAATTCGACAAGCAGGATAATATGAAGCTCCTAGGTCTAATCTGGTCACCGGTCGAGGATGAATTTTCAATCGCTATTAAATTCAACCCGCAAGCAAAATGTACAAAGCGCCTTATGCTTTCCACAATCGCTAAACTGTGGGACATAAACGGATTTTGTGCCCCTGTCATTTTACACGCAAAATTGTTAATAAAAGCTCTCTGGGTAGCTCAGATTGATTGGGATGCAGAGCCCCCAAGCGACATCTGTGCTGCATGGAAACGCTTTCTTAGTGAACTCCCCGCTCTGCAAGACTTTAAAATACCTCGCTTCGTAGGTATCGTGCCCGACTCCCGTGTCATACTACTGGGATTTGCGGACGCTTCTGAAAAAGCGATGGGTGCTTCTGTGTACATTTGTGTACAACCGGCTTCCGGACCAAATGAAGTCAATTTAATTGGTGCCAAAAGCAAGGTCGCGCCGCTCAAGATTGTTTCCTTAGCCCGCCTAGAGCTTTGTGCTGCTGTATTATTATCGAAACTGTTTCGATTTGTTATCGACACTGTTTCTCCCCGCTGTCATGTTGACGAAATTTTCGCGTTTACTGATTCGACAGTGACCCTCCATTGGGTTCACTCGTCTCCGCATCGCTTTGATACTTTCATTGCGAACCGCATCGCACAAATACAGAACAACCTTGACCCCAAACACTTCTACCATTGTGAAGGTACGCAGAATCCCAGCGACTGCTTGAGTCGTGGTCTCACACCCGCTCAATTATTGAATCACCCGCTGTGGCTCCATGGCCCCACATGGGCTCGTGATGACGTCCATACATGGCCCATCAACCGCTTCACGTTTGATCCCGCACAAGATGAAAAGATATTAGAGCTCAAAAAACAATCAAATGTCTTCATCACTACAGATGAGACAGAACCCTTTCTCTGTACGCTGGCCAAGCGCGTCTCTTCTTGAAAACTCACCGCCTTTACAATGGCCAATGGGCATAATTGA
Protein
MKTVKRLARDETDFPIASEITSDHLYMDDLGVSVDTPENGIQLAHDLIELFKRGGFDLVKFVSNSPEVLKSIPQANRLSSKIEFDKQDNMKLLGLIWSPVEDEFSIAIKFNPQAKCTKRLMLSTIAKLWDINGFCAPVILHAKLLIKALWVAQIDWDAEPPSDICAAWKRFLSELPALQDFKIPRFVGIVPDSRVILLGFADASEKAMGASVYICVQPASGPNEVNLIGAKSKVAPLKIVSLARLELCAAVLLSKLFRFVIDTVSPRCHVDEIFAFTDSTVTLHWVHSSPHRFDTFIANRIAQIQNNLDPKHFYHCEGTQNPSDCLSRGLTPAQLLNHPLWLHGPTWARDDVHTWPINRFTFDPAQDEKILELKKQSNVFITTDETEPFLCTLAKRVSSXKLTAFTMANGHN

Summary

Similarity
Belongs to the synaptobrevin family.
EMBL
GAIX01013989    JAA78571.1    GEZM01054789    JAV73399.1    GBBI01004276    JAC14436.1    + More
GBHO01044644    JAF98959.1    GBHO01044645    JAF98958.1    GBHO01044643    JAF98960.1    GBHO01027393    JAG16211.1    GALX01004947    JAB63519.1    GBHO01020799    JAG22805.1    APCN01002077    GDHC01006469    JAQ12160.1    GEBQ01015458    JAT24519.1    GEBQ01000825    JAT39152.1    GEBQ01028569    JAT11408.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GEBQ01005223    JAT34754.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    RSAL01000392    RVE41994.1    ABLF02004035    ABLF02004036    ABLF02004037    ABLF02004038    ABLF02008018    ABLF02008020    ABLF02012635    ABLF02061171    DS497760    EFA13225.1    GDHC01014057    JAQ04572.1    GBHO01039838    GBHO01006034    JAG03766.1    JAG37570.1    LBMM01007770    KMQ89434.1    GEZM01085145    GEZM01085143    JAV60187.1    LBMM01012238    KMQ86334.1    GALX01000776    JAB67690.1    GEZM01054766    GEZM01054765    JAV73410.1    GECZ01008071    JAS61698.1    EFA13221.1    JAV73413.1    GECZ01006169    JAS63600.1    LBMM01009496    KMQ88090.1    LBMM01005079    KMQ91831.1    LBMM01009688    KMQ87939.1    KQ971357    EFA07702.1    LBMM01024307    KMQ82592.1    ABLF02005684    GAMC01009674    JAB96881.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    LBMM01009403    KMQ88162.1    GALX01003138    JAB65328.1    LBMM01011244    KMQ86944.1    GEBQ01018232    JAT21745.1    LBMM01011245    KMQ86943.1    JYDQ01000959    KRY06068.1    GGMR01015135    MBY27754.1    ABLF02017056    GDHC01018192    JAQ00437.1    GBYB01000873    JAG70640.1    GAMC01021577    GAMC01021573    JAB84982.1    AJVK01027627    LBMM01012077    KMQ86420.1    ABLF02006985    ABLF02066034    GBHO01020765    GBHO01014531    JAG22839.1    JAG29073.1    GFTR01008866    JAW07560.1    LBMM01011492    KMQ86800.1    LBMM01010417    KMQ87475.1    LBMM01012188    KMQ86362.1    ABLF02041863    ABLF02008594    GGMR01005823    MBY18442.1    LBMM01009551    KMQ88039.1    LBMM01009442    KMQ88136.1    LBMM01009863    KMQ87831.1    GBHO01009080    JAG34524.1    ABLF02036131    ABLF02041527    ABLF02064049    GGMS01010524    MBY79727.1    LBMM01010405    KMQ87487.1   
Pfam
PF17921   Integrase_H2C2        + More
PF05380   Peptidase_A17
PF18701   DUF5641
PF00665   rve
PF05585   DUF1758
PF00078   RVT_1
PF03564   DUF1759
PF13774   Longin
PF16528   Exo84_C
PF02945   Endonuclease_7
Interpro
IPR041588   Integrase_H2C2        + More
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR001584   Integrase_cat-core       
IPR040676   DUF5641       
IPR036397   RNaseH_sf       
IPR008737   Peptidase_asp_put       
IPR000477   RT_dom       
IPR005312   DUF1759       
IPR021109   Peptidase_aspartic_dom_sf       
IPR011012   Longin-like_dom_sf       
IPR010908   Longin_dom       
IPR001995   Peptidase_A2_cat       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR032403   Exo84_C       
IPR016159   Cullin_repeat-like_dom_sf       
IPR000727   T_SNARE_dom       
IPR038563   Endonuclease_7_sf       
IPR004211   Endonuclease_7       
IPR001969   Aspartic_peptidase_AS       
SUPFAM
SSF53098   SSF53098        + More
SSF64356   SSF64356       
SSF50630   SSF50630       
SSF57756   SSF57756       
SSF74788   SSF74788       
Gene 3D

Ontologies

Topology

Length:
412
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.7992
Exp number, first 60 AAs:
0
Total prob of N-in:
0.08065
outside
1  -  412
 
 

Population Genetic Test Statistics

Pi
300.114394
Theta
145.341425
Tajima's D
3.658906
CLR
6.866997
CSRT
0.995650217489126
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号