SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08189
Annotation
gag-like_protein_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.947
 

Sequence

CDS
ATGGACGCTGTGTTCGCGGAATTCCTCCGACTTCGTCATCCACAGCTCGCCTCAGAGTTTCTGGCTTTCAAGGCCAATCACACTGCGAGCTCTCTCGAAGACTCCGCCGTGCTCGCTGCTCCTGCGTCGCCTGTACCTGCGTGCAAAGCTTCTACATCGAGCACCGCAACCTCCGTCGTGCCTGCCGTTCCCGCGTCGCCTATACTGGCGAGTAAAACTGCTGCGTCGTCCGCCGTAGCCACCGTTCCAGCTGTGCGATCATCCGCGGCCTCCGTCGCGCCCTCCAAAACACCTGCTCGTAGGTCACCGGCGCCCGCCTCTTCGTCCTCCGACTCTGACTCGGAGATGGAGGTCGACCTCGCCCCCGCCTCATCGACGGATGGATTTACCCTGGTACAAAAGGGTAAGAAGCGTGCCGCGGAGTCTCGAGCTCCCGCGGCCGCTAAAATTAGCAAAGCCGCGAACGCGTCGCGCCCCCGCCCCCAGACTCCCGTTGCGCCTCCAGCCCATGCCAGTCCGTCGCCGCGTCCGGTGGCACAAAATAAAACCCAGTCCCCTCCTCCGGTAATCCTTCAAGAGAAGGCAGCTTGGGATCGAGTTTCCCTGGCCCTTAAGGCCAAAAATATCAATTTCACGAATGCCCGTAACCTCGCGAATGGCATCCAAATAAAGGTGCATTCATCTGATGACCATAGGGCCCTCACCTCTTACCTCCGTAAGGAGCGTATAAGCTTCCACACTTATACGCTTCAGGAGGAGCGCGAACTCCGCGTTGTAATACGCGGAATCCCTAAAGAGTTAGATGTAGAGCTCGTAAAAGCCGACCTGTTAGAACAAGGCCTACCAGTGAATTCTGTGCACCGTATGCACACCGGTCGCGGTAGGGAGCCATATAATATGGTTCTAGTCGCTCTCCAGCCTACCCCCGAGGGTAAGAAAATCTTTAACACACAGACCGTCTGTAGGCTCTCTGGTATCGCTGTCGAAGCCCCCCATAAAAAAGGCACTCCTAGCCAGTGTCATAACTGTCAATTGTATGGGCACTCTTCCCGTAACTGTCACGCGCGCCCCCGATGCGTCAAATGTTTAGGCGATCACGCCACGGCCCTATGCACTCGCGATCAAAAAACCGCGACGGAACCGCCTAGCTGCGTCCTGTGTCGAACACAGGGTCACCCCGCAAATTACCGCGGATGCCCCCGAGCCCCGAAAATAAATCGCCGCGTCGCCCGCCAAAACCGCCTCCGAGCTTCCGGCCCAGACATCAGAGCTACGGCACCCTCTGCGTCGCAGGCTAAGCCAGCGTTCGTTCCGGCGGCGGTGCCCAGTGTCTCGGCCTGGGCGAAACCGCTGCCGTACACGAACACGGCTACAACTCCATCCTCCGCGATTCGTCCTGCCCCCGCGACTCGTCCCTCTCCCGCGACTTGCCCTCCGACCGCGTCCGAAAATCTCGCTTTAGCGATCGACTTCTTTCAGTCGATCAACTTTGAGCGCGTTAACGCTTTGGGCGACGCCATTCGCGCTGCCTCCACTGCACAACACTTTATCGCCGTTGTGCAGGAATACGCCGACGTATACGCGTCATTAAATACGTACGTCCTCCCCTCACTCCGCCGGTAA
Protein
MDAVFAEFLRLRHPQLASEFLAFKANHTASSLEDSAVLAAPASPVPACKASTSSTATSVVPAVPASPILASKTAASSAVATVPAVRSSAASVAPSKTPARRSPAPASSSSDSDSEMEVDLAPASSTDGFTLVQKGKKRAAESRAPAAAKISKAANASRPRPQTPVAPPAHASPSPRPVAQNKTQSPPPVILQEKAAWDRVSLALKAKNINFTNARNLANGIQIKVHSSDDHRALTSYLRKERISFHTYTLQEERELRVVIRGIPKELDVELVKADLLEQGLPVNSVHRMHTGRGREPYNMVLVALQPTPEGKKIFNTQTVCRLSGIAVEAPHKKGTPSQCHNCQLYGHSSRNCHARPRCVKCLGDHATALCTRDQKTATEPPSCVLCRTQGHPANYRGCPRAPKINRRVARQNRLRASGPDIRATAPSASQAKPAFVPAAVPSVSAWAKPLPYTNTATTPSSAIRPAPATRPSPATCPPTASENLALAIDFFQSINFERVNALGDAIRAASTAQHFIAVVQEYADVYASLNTYVLPSLRR

Summary

Pfam
PF07530   PRE_C2HC
Interpro
IPR006579   Pre_C2HC_dom       
ProteinModelPortal

Ontologies

GO

Topology

Length:
540
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01492
Exp number, first 60 AAs:
6e-05
Total prob of N-in:
0.00059
outside
1  -  540
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
115.200447
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号