SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08172
Pre Gene Modal
BGIBMGA009548
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 3.115
 

Sequence

CDS
ATGGAGGTAGATAGTGAGTGGAAAACGGACGATAAATCGCCGTTTAAGAAGATTGTGTTTGACATAGCTCCAATTAATTCCAGCAATGGATTAGACACAGTGCAATGTTTTTACTGTAGCATAGTTTCGGAAAAAGCAAATTTTTACGACTGGATTGGCGATCAATCCATGTCAAAGAATCACAAGTGTGCGTGTGAACAAGTGAGTACTGTTAAAATATTTATTCGCAGTGAACTAGAAAGGATCTCAGATGGTTCCGTTAAACTCCATACAAAGTATGTGCATTACCTCGCAAATGCGAACAAGCTCAAACAAGGCAAAGGCCCGCTGTGTGAATGCTCAGGACCGTTGTTCGTTCAAGTGATCGCACAAAACGAATTCATTATTCGCGAAAGAATAATATGTACATATTGCAAGAAGATGAGCCGCGTTGAGTTCAGATGCGACACCATCAAACCTATGACCAAAAAGCAAGTCGAGGGACCGTGGACGCCGGCTGCTAGAATAAGTCACACGAAAGAGCAATCTGCAAAAGATAATATTATGAAATATAATAAATCTAGAGGCATTAAAACCGTGGCGTCGCGGGACGCGAACCAAGCGTCACGTGATAACATAATTCCCAACTGGGGTTCACAAAGCGCGGGAATTCGACCGCAGCCAAAACCAAACCAAGAACATCGACCACGAGTAGAACCGAAGCCGACCGCCATACTAACAAGTAACATGTTTTCACCGCTTGCTTTTGATGAGGAAGAACGAGATAGGGAATCTGACGATACCATCTCAGTATTGAGTGAGGGTGGGGGCACCAAGCGACGACGTGTTCATAAGACACGGGCGGCATCTATTGGTGTCTCACCAGCGTATCTCTCTTTTGACAACATGGGACAAAGCAGTGCTCCAAATGGATCAAATAAAAATTTAACGAAGGATACAAGAACAAAGCGTTATCCTCCATTTATATGTGAATATGACGCATGGATCACGGATAAAAACGAGTGGAAGGCGGCGAATGAAATTGCTCGAGTGAGTAATTGTGAAATACGCGCTAATCCAAAGAGCAAGAAAATAACATTTATTCCAAAAAACAAGGAAGCTTATGAAGCCATACAGAGGCGACTAAATGAAAACCCAGACAAATATAATTACTACACATACGGATGCAAAGACGATCATCGCCCGGCAAAGAAGCTAATAGCTAAAGGGGTCCGCGCCGAAGGTTACACAGAGGAAGAAATCAAAGCCGATATTCTTGCAAGATATGGAATCAAGATGGAACGGGTAATTATTATGAAAAATTCAGCGTTGATTCTCATCTTCCCAGGTGAAACTGACATGCGAGTAGCCCGCGATATAAAGTTTATCTTAAGTCAGCGTGCTACAATCGAGAAATACAAGGTACGAGACACCGCGGTGACACAATGCAAGCGGTGCTGGCAATTTGGTCATGTGCAATCTCATTGCCGGCGTCCAGAGCAACCAGACTCTGTTGAACAACGCGAAGATGGAGATGTGTGGCATGTGTGCTACAACTGTCACGAAATTGGTCATACAGCAAGACAGGCAAAGTGCCCGCTATTCCAGTTAGAAATAAAAAAACAGAAAAACAGGCGACAGGCTTTCGTCAAAAATAATGAAGGACTTACACTACCCACAAAACGTATGATAGAAGCTTCGAATATAAAAGCAGCCCCAGCCACACGGGTCGACAGAACTAGCTATGCAGCAGCAGCAGGTGCCTTAAGTAGCCCTAAAACCACACGCAAGCCCCCTGAAAATGAATCCAAGGCAAAGGCGTTACCTGACTTACTCAGCAAAGCAAAAGAGTTGATGAAAAGTTTTAACAAAATTTACGATACTAGGGCAACTCACCTTGTCACTGCAATGTACATAAAGGAAGGTCTTCGCTGGAATCTAACGACTGTGATCCCAGGCGTGGATGACGTTGATCGTCGTATTGAGGGAGTAGCTATCAGGCTAGAAACAATTGACGGTGGTATCATCGTGCGAGGGTTGTATAATCCACACTTACGTTTCTATCAAATTCGGGCGGACTGGGAAGCTCTGTTAGAAGATAACACCACATCGATTAACGTGGGAGATTTAAATTTGAGAATGCAACAGCTTGGACACTCTCAAACACAAGCCGCAGGTGCGCTGGTGCAGCGGGCCATTGGCAACAGAGAGGCAAAATTGGTGCATACTGGCTTACCATCTCGACCCTGCCATCAAGGAAACGGTATACTCGATGTCGCACTGGTGACACAAGAGGCCATGGAGTACACTTATCGAACGAAGCAACTCGATTCTATCTCGTCAGATCACTATCCGTGGCAATTGGAAGTTGATATAGAGGTGCACGAACATGTGCTACTGAGGCGAAAGATGAACAGCATTACTGAATCTAAGGAGTCTCGCATCAAATTCCAAGAGCTAGTCGAAGCAAATCTTCCAGTAATTGTGCCAACCACTGATGCTGAGGCAGATTCATGCGTCGATAACTTGGAAAATGTACTCACTGCGGCATTAGATGAGATGGCGCCGCTACGAGAGTTAATACGACGAGAGGAACTACCAATAAACATCCAATACATGATACAACATCGCAACCGAAGCAAACTAAAAGCAAAAAATGCACCAAGAGGACATATTCTCCGTCGGATATACAACGCTGCAAAGACCATACTGAAGCAAGCGCTGCAAGAATATCGAGAGACCCAATGGAACAACGTCATTGATAGTCCTGAAAACAACAATGCTAAGATGTGGACTATTCAACGCTCTCTGAAGATCAAGCCTCAGCGTCTACCTGATCTACATGGAGTTGTAACTGAAGAAGAAACAATCAATACTCTGGTTGACACGGCAATAGTAAAAGAAGCAAATGTGGATGACACTCATAAAAATTCTGAGACCTTTACCCCATACCAACCGCTGGCCGAGACCGACGTAGACGAGGTAATACGAGCTCTTCGCCTCTTCAAGAACAAGAAAGCGCCAGGCCCCGATCAACTAAGGGCTGACGCAATAAAACTTGCTGGCCCAGCATATTATACAGCACTGACAAACACAATAAACTACACTCTACGCACAGGATATTATCCAAGCCGATGGAAGCTGGGTGACTGTATCTTCTTACACAAACCAGGCAAACCACATACCGAAGCTGCCTCGTATCGTCCCATTATGTTACTTAACATTATGGGTAAGCTGTGCGAACGAGTTATGTATAGCAGAGTTCTCTCAGAAGTGAACCGTTTGCATCTTATCCCAGAATACCAGCACGGTTTTACAAAAAATAAAGGGACTGGTACCCAAATTTTACGAACTGGTAAGGTTATTACAGACGCTTTGGCAGAGGGCAACAGTGTAGCGATGATTTCTACTGATCTCAGTAAAGCTTTCGATTCCATAAATCACGCAGGGCTAAGCAAGAAACTGTTTAACGCTGGAATGGCAAATAATGTAATTAAGCTAATAGAGAATTACCTGAAAAATCGGGAGGCTCGTGGTAAGTACCGAACAATGTATGGAAAAAGGCAGCCGATTCCGCACGGGGTACCACAGGGCTCAATTTTGGGGCCGATCCTCTTCAACTTATACATGAGTGATATCCCCAAGACCCACATCGCAGGTATCACACTCTCACAGTATGCTGATGATCTATGCATCCTGAATGAGGCTAGCCAACCAGATACAGCATCGCGGAGAGCGGCATGGGCTGCTGAGACGATTATAAACTACTACAAGGAATGGGGTCTGCAGTGCAATGTGAGCAAAACGGATTGCATAATGTTTACAAATAAACGCAAATTTAATCGCACCATACAACTTCAACATGAGGCATTACCAATAAAAAGTAACAAAAAATATCTTGGAGTGCATCTCGACCAAAGATTAGTGATGAAGGAACATGTAAAAAACACAGTGAAAAAAGTAAAACAAGTGCGTGGAATGCTAGCGCCTATCATAGGATGGTATAGTAAAGTGTCCCTTGAAATAAAACTTAAAGTGATCAAAGCAACTGTTCTACCAATCATTGATTACGGCATTGTACAACTATACCCTAGGGTATGTAAGTCTAAGCTAACTGAATTAGAGAGGCAATATCGAATGGCATTGAAGACAGCGGGTAACTTTCCTCGCAATACGAGTTCAGAAGTAATCTGGGAAATGCTTGATGAGGATCCGTGGTACATACGTGCCAGGGACCTTCATGAAGATATGCTCCGCAAGTTAAAAGATCAGCAAATCCCTGGACTTACACTCCCTGGGAATAAATATGATAAACTGAACCACCATAATCCTATGTTGCCTAGCCTGCGCGCAGGTGAAATCGATTATGTTGACAAAAAAGAAAGAGGCAAACCGCTCTCCAAGCGAACGGTTCCTCCTCGTATTCCTATCCTTTAG
Protein
MEVDSEWKTDDKSPFKKIVFDIAPINSSNGLDTVQCFYCSIVSEKANFYDWIGDQSMSKNHKCACEQVSTVKIFIRSELERISDGSVKLHTKYVHYLANANKLKQGKGPLCECSGPLFVQVIAQNEFIIRERIICTYCKKMSRVEFRCDTIKPMTKKQVEGPWTPAARISHTKEQSAKDNIMKYNKSRGIKTVASRDANQASRDNIIPNWGSQSAGIRPQPKPNQEHRPRVEPKPTAILTSNMFSPLAFDEEERDRESDDTISVLSEGGGTKRRRVHKTRAASIGVSPAYLSFDNMGQSSAPNGSNKNLTKDTRTKRYPPFICEYDAWITDKNEWKAANEIARVSNCEIRANPKSKKITFIPKNKEAYEAIQRRLNENPDKYNYYTYGCKDDHRPAKKLIAKGVRAEGYTEEEIKADILARYGIKMERVIIMKNSALILIFPGETDMRVARDIKFILSQRATIEKYKVRDTAVTQCKRCWQFGHVQSHCRRPEQPDSVEQREDGDVWHVCYNCHEIGHTARQAKCPLFQLEIKKQKNRRQAFVKNNEGLTLPTKRMIEASNIKAAPATRVDRTSYAAAAGALSSPKTTRKPPENESKAKALPDLLSKAKELMKSFNKIYDTRATHLVTAMYIKEGLRWNLTTVIPGVDDVDRRIEGVAIRLETIDGGIIVRGLYNPHLRFYQIRADWEALLEDNTTSINVGDLNLRMQQLGHSQTQAAGALVQRAIGNREAKLVHTGLPSRPCHQGNGILDVALVTQEAMEYTYRTKQLDSISSDHYPWQLEVDIEVHEHVLLRRKMNSITESKESRIKFQELVEANLPVIVPTTDAEADSCVDNLENVLTAALDEMAPLRELIRREELPINIQYMIQHRNRSKLKAKNAPRGHILRRIYNAAKTILKQALQEYRETQWNNVIDSPENNNAKMWTIQRSLKIKPQRLPDLHGVVTEEETINTLVDTAIVKEANVDDTHKNSETFTPYQPLAETDVDEVIRALRLFKNKKAPGPDQLRADAIKLAGPAYYTALTNTINYTLRTGYYPSRWKLGDCIFLHKPGKPHTEAASYRPIMLLNIMGKLCERVMYSRVLSEVNRLHLIPEYQHGFTKNKGTGTQILRTGKVITDALAEGNSVAMISTDLSKAFDSINHAGLSKKLFNAGMANNVIKLIENYLKNREARGKYRTMYGKRQPIPHGVPQGSILGPILFNLYMSDIPKTHIAGITLSQYADDLCILNEASQPDTASRRAAWAAETIINYYKEWGLQCNVSKTDCIMFTNKRKFNRTIQLQHEALPIKSNKKYLGVHLDQRLVMKEHVKNTVKKVKQVRGMLAPIIGWYSKVSLEIKLKVIKATVLPIIDYGIVQLYPRVCKSKLTELERQYRMALKTAGNFPRNTSSEVIWEMLDEDPWYIRARDLHEDMLRKLKDQQIPGLTLPGNKYDKLNHHNPMLPSLRAGEIDYVDKKERGKPLSKRTVPPRIPIL

Summary

Pfam
PF07530   PRE_C2HC        + More
PF14529   Exo_endo_phos_2
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.000104057,     Score=114

Ontologies

Topology

Length:
1471
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01164
Exp number, first 60 AAs:
0.00048
Total prob of N-in:
0.00014
outside
1  -  1471
 
 

Population Genetic Test Statistics

Pi
321.076441
Theta
207.181914
Tajima's D
1.837199
CLR
207.486139
CSRT
0.848857557122144
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号