SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08171
Annotation
PREDICTED:_zinc_finger_BED_domain-containing_protein_1-like_[Amyelois_transitella]
Transcription factor
Location in the cell
Nuclear   Reliability : 2.942
 

Sequence

CDS
ATGGGACCTAAGAAAAAAAGTTCCGTTTGGCAGTTCTTTAACAAAATTGACGATAAGAAAACGAAATGCAAACTATGTCAAAAGGAAATTAAGTCTGCTGGAAACACTACGAACTTAATTGGACATATTCGTAATGTTCATAAGGCTGCTTATCTCGAAATTCAGCCGAAACAAACTACATTCAATGCAGTAACTACTACAGACGAAATATCGAATCCTCTGGATCTGGATACCAAAGTTACGCCTTATAATAAAATGGATGATGGAGTACTTCAGTTTCAACCTGTTCCAAGTTGCAGTGGCAGTCAAAGATCCGGTGCACCGTTACCAAAAACCGTAAATGAAACCATTGATTCAGACTTAGACGAAAACGTTACACCTTTAAAACGCCAAAGAACAATACAGGCCGCTTTTAAAGATATTTCCTCTTACTCAGAATCTGGAGCGAAGACAAGGAAACTGAACAACTGTTTGTTATTCATGATTTGCAAAGACCATCAGCCATTCTCAATCGTTGAAAACGAAGGCTTCAAAACTCTAATGAAAACAGTTGCTCCTCAATATAAGCTCCCGAGTAGAACAACTCTAAGACGCTGGCTGGACGATAAATATGAAGTAATTTCAGAAACAATTAAGAAAATGTTGTCCTCTATAGAAGATATAACCCTAACAACAGATATTTGGTCGGATACCTTGAATATGAAAAGTTTTTTGGGCATCACAGCACATTTCGGAATAGACATTGAACTATATTCAGTCACCTTAGGTGTGTACGAATTGGATGAAAGACATACATCAGATTATCTTTCTGAAATTCTCTTAAAGGTATGTCAAGACTGGAAAATCGATCAAGAGAATGTAACAGCTGTTGTTACTGACAACGCAGCCAATATAGTTAAGGCGATCGAATTAGCGTTTGGTAGAAGGAAACACATCCCATGTTTTGCCCATACTCTGAATTTGGTGGCTGAAGGCACAATGATATGTATTGAGTGGAGAAACATTGTTTCTAAAGTAAAATCAATAGTGACTTGGTTTAAACAGAGTTGCATTGCTAGTGATGAATTACGTAAAGCTACTGCTGCGGCTACGGAGTCTTCTGCTGGAGCAGCTGAGGTAAAATTAATACAAAGCGTGGATACTCGCTGGAACAGTACATATTATATGTTACAAAGATTTCTAGAACTCCGTAGTGTCATAAATGATATTCTCTTCCGCCACCCTAGAGCACCTGCAATGCTGAGTGCATCGGAAATATCTACTGTATCGTCTGTCATCATGGTATTGCGACCCTTAGAAGCGGCTACAAAAGAAATTTCAGGTGATAAATACTGCACAAGTAGTAAAATTATTCCCTTAGTTCGTTGCATGCTCTCTAAAATAACTTCAGCTGTTATAGAAGATCCCGTAGCGAAAGAGGTGCAGAAACTTGCTATTAATGAAATAAATAAAAGAATGGGTTCAATAGAACATGTGAATGCTCTGGCTATCGCAAGTATTTTAGATCCACGGTTTAAAAGAATGCATTTCAATGATCCGATAGCTTGTTCGAATGCTGTTACGAAAATTAAAGATTTAATGAAGAAGAATTTGCATAGCAATGAAGAACCTGAGTCCGATTCTGACAAGTCCGATAAAAATGAAGAGGCCTTTTCATTATGGACTGATCACCATAAGTTAGTGCATCGTAACTGGAAAATTAACAAATCTGAAGACGTTTTGTCTGACGAACTTTCCGTTTATCTCCGAACTCCTGTTGGAAGACTTAAAGAAAATCCGTTAGAAATTTGGTGA
Protein
MGPKKKSSVWQFFNKIDDKKTKCKLCQKEIKSAGNTTNLIGHIRNVHKAAYLEIQPKQTTFNAVTTTDEISNPLDLDTKVTPYNKMDDGVLQFQPVPSCSGSQRSGAPLPKTVNETIDSDLDENVTPLKRQRTIQAAFKDISSYSESGAKTRKLNNCLLFMICKDHQPFSIVENEGFKTLMKTVAPQYKLPSRTTLRRWLDDKYEVISETIKKMLSSIEDITLTTDIWSDTLNMKSFLGITAHFGIDIELYSVTLGVYELDERHTSDYLSEILLKVCQDWKIDQENVTAVVTDNAANIVKAIELAFGRRKHIPCFAHTLNLVAEGTMICIEWRNIVSKVKSIVTWFKQSCIASDELRKATAAATESSAGAAEVKLIQSVDTRWNSTYYMLQRFLELRSVINDILFRHPRAPAMLSASEISTVSSVIMVLRPLEAATKEISGDKYCTSSKIIPLVRCMLSKITSAVIEDPVAKEVQKLAINEINKRMGSIEHVNALAIASILDPRFKRMHFNDPIACSNAVTKIKDLMKKNLHSNEEPESDSDKSDKNEEAFSLWTDHHKLVHRNWKINKSEDVLSDELSVYLRTPVGRLKENPLEIW

Summary

EMBL
ABLF02010709    ABLF02009488    ABLF02008875    GDQN01002674    JAT88380.1    ABLF02030582    + More
ABLF02006015    KQ977395    KYN02984.1    GL441080    EFN65135.1    ABLF02001734    ABLF02023260    KQ980290    KYN16919.1    KQ978037    KYM97822.1    LBMM01014067    KMQ85349.1    ABLF02011645    ABLF02044591    ABLF02050984    ABLF02055777    GL452203    EFN77752.1    KQ980204    KYN17277.1    LKEX01009590    KYN50115.1    KQ979507    KYN21183.1    KK107050    EZA61658.1    ABLF02026056    ABLF02057203    KQ980913    KYN11465.1    QOIP01000003    RLU24471.1    GGMS01006357    MBY75560.1    KK107161    EZA56605.1    GGMS01015207    MBY84410.1    ABLF02017802    LBMM01003701    KMQ93224.1    KQ977255    KYN04655.1    KK107725    EZA47986.1    RSAL01000257    RVE43413.1    GFTR01007466    JAW08960.1    AF486809    AAL93203.1    ABLF02018406    CAEY01000199    ABLF02012532    CAEY01000832    ABLF02006624    ABLF02006626    GGMS01006230    MBY75433.1    GL436768    EFN71507.1    NNAY01004948    OXU17200.1    ABLF02021118    ABLF02014501    ABLF02011646    ABLF02013863    ABLF02067360    CAEY01001590    GBXI01000181    JAD14111.1    GGMR01013943    MBY26562.1    HACA01026053    CDW43414.1    NWSH01001073    PCG72760.1    ABLF02055338    PCG72759.1    KQ980971    KYN10910.1    ABLF02011642    GAKP01011699    JAC47253.1   
Pfam
PF05699   Dimer_Tnp_hAT        + More
PF04937   DUF659
PF02892   zf-BED
PF13843   DDE_Tnp_1_7
Interpro
IPR037220   BED_dom        + More
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
IPR007021   DUF659       
IPR036236   Znf_C2H2_sf       
IPR003656   Znf_BED       
IPR029526   PGBD       
SUPFAM
SSF140996   SSF140996        + More
SSF53098   SSF53098       
SSF57667   SSF57667       
PDB
6DX0     E-value=4.18294e-14,     Score=191

Ontologies

Topology

Length:
597
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02103
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00168
outside
1  -  597
 
 

Population Genetic Test Statistics

Pi
215.500937
Theta
212.011977
Tajima's D
0.040815
CLR
0.000861
CSRT
0.383380830958452
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号