SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08153
Pre Gene Modal
BGIBMGA004212
Annotation
hypothetical_protein_OBRU01_05243_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 4.126
 

Sequence

CDS
ATGGTTCCGACCCCAAAAGATGATAGGCCATCAACACCGGTTTTAAAGCCAGCAACACCAGTATCAGTTCCCGGAACATCCCAACAGTTGCCAGTTCAATCAACTGGCACAAACAGTAAAACCGATGAGCTGCTGCGAAAACAACGTAGCAACTACAAGGCATTCGAGCATACTGTTGCTAACACCAACTTGGACCTTATCACCGAAAAGTGGGAGTTTGATAATGTCCTACGTAACATTCAATCTCGGTGGACATTGATCGATGCCTCGCACTGGGAGTTGGATAATCATAATACACTTCTTCACGACGCTTACGACAAATGGGGCGGAAAGACATCAAACAACAGATCAGTGCAGCAAAACACAGCCGTCGCTGATAGCAAGAAAACTAGTAGCACTAACGCCAATCATGTGTCTCAAGAAGACGTATCAGAAACTCTGCTTACCACAGCATTAATCAACGTGCAAGCAAACGATGGGTCCCTGATAACTTTGCGAGCACTCCTTGATCAGGGTTCACAAACATCCCTGATAACGGAAAAAGCAGCGCAAAAGCTACGAATACCACGTGGCCGCTGCAAAGGGGTCATATTCGGCGTCGGAGCTAAAGAAAATAATTGCAAAGGCGTCATAAGAATCACGTGCAGTGCCATTTATAGTGATTATACATTTGACACCGATGTATTCATTATGCGCAATTTAATAAACAATTTGCCGAATAGATCATTTAAAAAGCCAAAATCATGGAAGTTTTTAGAGAACATCACGTTGGCTGATCCAGATTTTAATGAAAGTCGCCCTGTAGACATTTTACTTGGGGCCGATATATACTCAAACATTATTCAAGAAGGTATCATCAGGCACGAAAAATCACAACCAGTTGCACAACAAACGCGCTTGGGCCGGATTCTATGCGGGACCGTGCAGAGAACATTCCAGTGCAACGTTGTGATAAATAACATCGATGACATTCGACAGTTTTGGTCAGTTGAAGACATAGCAGAAAACTCGAGGATGTCACAGGATGATCTGGATTGTTTGCAGCACTATAAGAACACAACAGCTCGTAACGAAGAAGGTCGTTACACTGTTGAGCTGCCATTCATACCAAACTTTCAAGAAAAACTAGGAGCTTCGAAACCCATGGCTTTGGCACAATTCCGGCAACTTGAGAGGAAATTTAGCAAACAACCACAATTAGCAGAATCATACAGACAGTTCATTCATGAATATCAGGCAATGAATCATATGAGGTGGCAATCCGAATATCTCGCTCAACTCTCAACGAGGAGCAAATGGCAAAGACCTCATGAAAATGTACGAGTTGATGACGTTGTCATCATTCATGAGCCTAACCTTCCCGCAGGAAGATGGGCTCTAGGCAGAGTCACTGAGCTTCATCCCGGCTCCGATGGACTGGTCCGGGTAGTTACCCTGAAAACAAAAACTGGGTATATCAAGCGCCCAGTGATTAAACTATCAGTATTGGTATCTAACCCGAAAGCAACCGATCAGGCAGGGAAGATATCAGACAAACCAACAATCAAGAAGAAGGATGACCAATCAAAATGTCGACCTGGAACGGCGTCAAATTTGATAGCAACTCTCATTACACTATTCCTTTTCATGACGTCAGTTTTTGGCCACCAGCAACCAACATCTCCATATAGTTTGACAACGATTCACAAAGCACTATACTTTGACCGAATCTCGAGCGTGCAATTTATACAAGATGAATGGAAACTCATCGTGTATCACGACATGAGCCCTTATTGGGACGGTTCAGAAACCTTCAAGAAATACCTTCAACAAATAACCAACGTATGCGAAAGAGAGACAAACACGGCACTATGTGACATTATCATACTACAACTACGTCATGCTCATGACGAACTAAAGTACTACAACGAAATATTAATGAATCAGCATGTCGAAGAACGCACCCGGAAGAGACGAGGCCTCATCGACGGTGTGGGCTATGTTGCTAACAGTTTATTTGGAGTTTTGGATCAACGTTTCGCCGATCAATACAAGCAGGATATTTCTCTTATAAAAAGAAATGAAGAACACTTAGGACTCCTGTGGAAAAATCAGACCTCAGTTGTAGAAGCGGAATATAATTTACTCAAAAGAACTGAGGAATCGATCAATCGGCAACACAAAGTCATTAATCAACATTTAAACAATTTAACAAAGGCCACTAACATTTTGAACAAAAATCTGGAGGAACAAGAAGTGATGAACGAACTAGCACTCTCCACAATCATAGCTACCAATATGCTCGCGAAGCTAAAATCGATACAAGATACAATAATCGACACGATAACAGATATCCATCATGGAATATTCAATGTCCATTTACTATCGCCGAAGCAATTACAAGATCAACTCCGCATTATTTCCGGACAATTATCGCGAGAGCTATCCTTACCGATGGAAAACATACAGTCGGAACTACCCAAAATTTATCATCTTCTGAAGGTCAAAGCAAGGGTAACACAACAGTACCTTATATTTGAAATCAGAATACCACTTGTCAGCAGGGAGAGTTATGACTTATATCAATTGATATCAATACCACAACAACATGGAAACGCCACAGTCGTCGTCGTGCCGGTATCAGATTACATCGCAATAAATTTACGCAAAGATACTTACTTAGCAATGTCGGCAAGAGACATACAACATTGTGTCCAGTACGATGACTTAACTCGTCTCTGTCACTCTCGAAAACCTATTTTTCAATTTAAGTCAGAAGACAGCATGTGCATCAAAGATAAGAGCACCAACAGGTGTCTTACAAGCACTGCAGCGTGCCGCAATAATTGGATGGAGTTGAGTAGAACAAATACTTACCTTTATTATTGTTGCGGGCAATGTGCACTGCGCGTTATATGTGAGCATCAGATTACTGCAATACAAGTCGCTAAGGCCGGGGTCATTACACTGGATTCTGATTGCGTAATTAAAGGTGAAGACTTCACCGTTTTTTCACATAAACCACTACACTCAGAAGTTAAAACTGCGACTGACTTGGAATCACAGCAAATAGCACCGATCAATCACATCATCAACGTCTCTGTGCCGGAACTTGAATTCAACATCACCGATCACCAAGCTTCATTTCGGCACATTAAGGAACAGATTGAGGAGATGAAGTCAGAAAAGGCTTTGTACTCTGAAATATCAAGCCATGACATACATCAATATTCAGTAATCTACGTGTTGGTTTTGGTTGCTGTGTTGACAGTAATAGTTTTCCTTTGTCGGTGGTTTTATCGTCGTCGGCAGAGGAGCGCCGACTTAGAGTCGGACTCCGAGGTGCAGCCTCCAAAGGTGCCGGCGCGCAGAGGGTTTGCCACCTCCGTCGTCGGTACGACGCCACACACAAGATACGCAAATCATCAGTCGCGAGAAGAGACCGTTGAATTGAGGAATTTTAATAGCATATTCAGCAGCATAAAGCGGCACGAGAAAACACCTCCAGTGCTTACCAAACCAGTGTCTACTGACAGTGACTGA
Protein
MVPTPKDDRPSTPVLKPATPVSVPGTSQQLPVQSTGTNSKTDELLRKQRSNYKAFEHTVANTNLDLITEKWEFDNVLRNIQSRWTLIDASHWELDNHNTLLHDAYDKWGGKTSNNRSVQQNTAVADSKKTSSTNANHVSQEDVSETLLTTALINVQANDGSLITLRALLDQGSQTSLITEKAAQKLRIPRGRCKGVIFGVGAKENNCKGVIRITCSAIYSDYTFDTDVFIMRNLINNLPNRSFKKPKSWKFLENITLADPDFNESRPVDILLGADIYSNIIQEGIIRHEKSQPVAQQTRLGRILCGTVQRTFQCNVVINNIDDIRQFWSVEDIAENSRMSQDDLDCLQHYKNTTARNEEGRYTVELPFIPNFQEKLGASKPMALAQFRQLERKFSKQPQLAESYRQFIHEYQAMNHMRWQSEYLAQLSTRSKWQRPHENVRVDDVVIIHEPNLPAGRWALGRVTELHPGSDGLVRVVTLKTKTGYIKRPVIKLSVLVSNPKATDQAGKISDKPTIKKKDDQSKCRPGTASNLIATLITLFLFMTSVFGHQQPTSPYSLTTIHKALYFDRISSVQFIQDEWKLIVYHDMSPYWDGSETFKKYLQQITNVCERETNTALCDIIILQLRHAHDELKYYNEILMNQHVEERTRKRRGLIDGVGYVANSLFGVLDQRFADQYKQDISLIKRNEEHLGLLWKNQTSVVEAEYNLLKRTEESINRQHKVINQHLNNLTKATNILNKNLEEQEVMNELALSTIIATNMLAKLKSIQDTIIDTITDIHHGIFNVHLLSPKQLQDQLRIISGQLSRELSLPMENIQSELPKIYHLLKVKARVTQQYLIFEIRIPLVSRESYDLYQLISIPQQHGNATVVVVPVSDYIAINLRKDTYLAMSARDIQHCVQYDDLTRLCHSRKPIFQFKSEDSMCIKDKSTNRCLTSTAACRNNWMELSRTNTYLYYCCGQCALRVICEHQITAIQVAKAGVITLDSDCVIKGEDFTVFSHKPLHSEVKTATDLESQQIAPINHIINVSVPELEFNITDHQASFRHIKEQIEEMKSEKALYSEISSHDIHQYSVIYVLVLVAVLTVIVFLCRWFYRRRQRSADLESDSEVQPPKVPARRGFATSVVGTTPHTRYANHQSREETVELRNFNSIFSSIKRHEKTPPVLTKPVSTDSD

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
1173
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
22.5447
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01553
outside
1  -  1069
TMhelix
1070  -  1092
inside
1093  -  1173
 
 

Population Genetic Test Statistics

Pi
4.209481
Theta
20.189507
Tajima's D
2.290171
CLR
0.322397
CSRT
0.925803709814509
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号