SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08152
Pre Gene Modal
BGIBMGA014373
Annotation
PREDICTED:_protein_toll-like_[Bombyx_mori]
Full name
Protein toll      
Location in the cell
Nuclear   Reliability : 1.08 PlasmaMembrane   Reliability : 1.192
 

Sequence

CDS
ATGGACCTCTGCCCCGGCAACTCCAACGCACACGTCGGCTCCGGCACTTCCCCGCTAAAAGCGCTGACGGAGTTGGATGAGCTGAGACTGGGTCACACGGGTGTGTCTCACGTGTGCAGCGACTGGCGGACCTCCATGAAGCAACTCAGTCTTCTCGATCTCTCCTACACAAACATCACCTCCCTGTCGTACCTGGATTTCCACTACGAGCGCTCTGGATCCAAAAAGCTGACCGTGAACTTCAACGGCACGCCCGTCAGCGAGCTCACCGTCGACGCGGGGAACTACAAGTCTGTGATCGCCGACCTGGCATCTGCATCGGTCAAGATAATATTGAGAGCAACTTTACCGTGCGACTGCTTGGACTACTGGACGGCACTGGCGTTCGGGAACCTCAGCACTCAAGCACAAGATTCCGTGGAGCTCCTGTGTAGGGAGGAGGAGCGTGGTTCACTAGCGGACGCGTTGGAACGGGAATCTCTGGAGTGTGCGGAATCGAGCCTGTGTGAGGACCAGGAAGGCTGCACCTGTTCCGTACGCCCTGACCTCTCGCATGGTGTGGTGGCGACCGCGTCATGTGAGGGCGCGGGTCTGGACGAAATGCCATCGCGTCTGAAGTTCAAAGAGGCTCCCGCGTGGCGCTTAATGCTCGCCCACAACCACATCCAGACCGTTCGGTTTCAGGATCTGCCCGACACGATATTGGAGTTGGACCTGAGAAACAACTCTCTGCATAGATTGGACGGCCCGACTGCTTCGAAGTTATCAACTGTCCCTCTGTGGATCGCCAACAATTCGCTGGACTGCACATGTCACGGGTACGACTTGGTGACGAACCTCGAACTGTGTGTGCTCGACATGGAGCAAGCGACGTGTGACGACGGGACCCCTCTAATTGAAGCACAGATCAACGATCCCACTGAATGCAGTTCGTTTGTAACGGTCACCGTCTCTTTGATCAGCGCGCTGGCTTTGTTGGCAGTGATGGTCGCAGTTACAGCCGGCTGCGGGATGCGACCCGAGATGCGGCTGAGAGTTAAGGTGCTGCTGCTGCGACTGGGCTGGCTGCCACGGCGGCCGGAGCCGGACGACGGGCGTCGGTTCGATGCGTTCGTATCGTACGCGCACGAGGACGAGGCGGTGGTGGAAGAGCTCGTGAAGCGGCTTGAGGTGGGGCACGGCTACCGGCTGTGCCTGCACTACCGCGACTGGCCGCCGGGCGAGTGGATCCACGTGCAGATCGCGGCCTCGGTGCAAGCGGCGCGCCGCACCCTCATCGTAGTCTCGCGGCACTTCCTGCGCTCCAAGTGGGCGCGCCAAGAGTTCCGCCAGGCACACGCGGCCGCGCTGCGTGACGTCACACCGCGCCTCGTGCTGCTGTTCCTCGAGCCGCCGCACCGCTTGCCTCTCGACGCCGAGCTGCGCTCCTACATTAGGATCAACACCTACCTGCTCTGGACCGACCCCTGGTTCTGGCACAAACTAAAGCTAGCCCTGCCGCCCCCGCGCCTGCTCCCCACCCCGTTCGAGGATGTCTCCGTTAATAAGGCGGAGAGCTCCCCTCTACAAGTAGCGCCACGCCCGCAGAGTGCGTGA
Protein
MDLCPGNSNAHVGSGTSPLKALTELDELRLGHTGVSHVCSDWRTSMKQLSLLDLSYTNITSLSYLDFHYERSGSKKLTVNFNGTPVSELTVDAGNYKSVIADLASASVKIILRATLPCDCLDYWTALAFGNLSTQAQDSVELLCREEERGSLADALERESLECAESSLCEDQEGCTCSVRPDLSHGVVATASCEGAGLDEMPSRLKFKEAPAWRLMLAHNHIQTVRFQDLPDTILELDLRNNSLHRLDGPTASKLSTVPLWIANNSLDCTCHGYDLVTNLELCVLDMEQATCDDGTPLIEAQINDPTECSSFVTVTVSLISALALLAVMVAVTAGCGMRPEMRLRVKVLLLRLGWLPRRPEPDDGRRFDAFVSYAHEDEAVVEELVKRLEVGHGYRLCLHYRDWPPGEWIHVQIAASVQAARRTLIVVSRHFLRSKWARQEFRQAHAAALRDVTPRLVLLFLEPPHRLPLDAELRSYIRINTYLLWTDPWFWHKLKLALPPPRLLPTPFEDVSVNKAESSPLQVAPRPQSA

Summary

Description
Receptor for the cleaved activated form of spz, spaetzle C-106 (PubMed:12872120). Binding to spaetzle C-106 activates the Toll signaling pathway and induces expression of the antifungal peptide drosomycin (PubMed:12872120, PubMed:8808632, PubMed:10973475). Component of the extracellular signaling pathway that establishes dorsal-ventral polarity in the embryo (PubMed:3931919). Promotes heterophilic cellular adhesion (PubMed:2124970). Involved in synaptic targeting of motoneurons RP5 and V to muscle 12 (M12); functions as a repulsive cue inhibiting motoneuron synapse formation on muscle 13 (M13) to guide RP5 and V to the neighboring M12, where its expression is repressed by tey (PubMed:20504957). May also function in embryonic neuronal survival and the synaptic targeting of SNa motoneurons (PubMed:19018662).
Subunit
In the absence of ligand, forms a low-affinity disulfide-linked homodimer (PubMed:24733933). In the presence of ligand, crystal structures show one Tl molecule bound to a spaetzle C-106 homodimer (PubMed:24282309, PubMed:24733933). However, the active complex probably consists of two Tl molecules bound to a spaetzle C-106 homodimer (PubMed:24282309, PubMed:24733933). This is supported by in vitro experiments which also show binding of the spaetzle C-106 dimer to 2 Tl receptors (PubMed:12872120). Ligand binding induces conformational changes in the extracellular domain of Tl (PubMed:24282309). This may enable a secondary homodimerization interface at the C-terminus of the Tl extracellular domain (PubMed:24282309).
Similarity
Belongs to the Toll-like receptor family.
Keywords
3D-structure   Cell adhesion   Cell membrane   Complete proteome   Cytoplasm   Developmental protein   Disulfide bond   Glycoprotein   Immunity   Innate immunity   Leucine-rich repeat   Membrane   Polymorphism   Receptor   Reference proteome   Repeat   Signal   Transmembrane   Transmembrane helix  
Feature
chain  Protein toll
EMBL
BABH01040363    BABH01040364    BABH01040360    BABH01040361    ODYU01007053    SOQ49485.1    + More
EF442782    ABO21763.1    JTDY01000372    KOB77487.1    KQ435801    KOX73247.1    GDKW01003048    JAI53547.1    ACPB03009442    KQ414914    KOC59528.1    GFTR01008481    JAW07945.1    KQ981880    KYN33933.1    KK107356    QOIP01000010    EZA52048.1    RLU17569.1    MH243021    AXS59155.1    KQ979262    KYN22067.1    GL447175    EFN86808.1    GL887553    EGI70800.1    ADTU01008265    KQ775195    OAD52269.1    KQ434773    KZC03990.1    DQ923424    ABK58729.1    EF117252    ABO38434.1    NEVH01013973    PNF28084.1    KK852931    KDR13629.1    GU014556    ADK55066.1    EF407561    ABQ59330.1    PNF28085.1    EU433386    ACC68670.1    CH933806    EDW16578.1    NNAY01000160    OXU30431.1    KZ288197    PBC33714.1    AY124197    AAM97776.1    AB385869    BAG68890.1    GBHO01026374    GBHO01026373    GBHO01026372    GBHO01026370    JAG17230.1    JAG17231.1    JAG17232.1    JAG17234.1    GDHC01015553    GDHC01008551    JAQ03076.1    JAQ10078.1    KJ188411    AHL39101.1    MH178390    QAT92918.1    KP274553    AJC98699.1    JXUM01078342    JXUM01078343    KP274549    AJC98695.1    CH954182    EDV53507.1    JF895474    AEI25533.1    CH940650    EDW67652.2    KRF83383.1    APCN01004779    APCN01004780    CM000160    EDW98589.2    AY349924    AAQ64875.1    L25390    AAA28942.1    AY349921    AAQ64872.1    CM000364    EDX14589.1    AY349918    AAQ64869.1    AY754607    AAX13182.1    AJWK01023878    AY349920    AAQ64871.1    OUUW01000005    SPP81101.1    CP012526    ALC46724.1    KP274543    KP274546    AJC98689.1    AJC98692.1    KP274533    KP274534    KP274535    KP274536    KP274537    KP274538    KP274539    KP274540    KP274541    KP274544    KP274551    AJC98679.1    AJC98680.1    AJC98681.1    AJC98682.1    AJC98683.1    AJC98684.1    AJC98685.1    AJC98686.1    AJC98687.1    AJC98690.1    AJC98697.1    AF444780    AAAB01008811    AAL37901.1    EAA45376.1    AY352264    AAQ65064.1    KP274545    KP274548    KP274550    AJC98691.1    AJC98694.1    AJC98696.1    KP274552    AJC98698.1    KP274542    AJC98688.1    AY349917    AAQ64868.1    AY349922    AY349923    AAQ64873.1    AAQ64874.1    AY754609    AAX13184.1    AE014297    AGB96375.1    BT150335    AGW25617.1    M19969    BT031153    AY349649    AY349650    AY349651    AY349652    AY349653    AY349654    AY349655    AY121616    CM000070    EAL27102.2    KJ188410    AHL39100.1    KP274547    AJC98693.1    AY124195    AAM97774.1    GFDF01000994    JAV13090.1    CH477273    EAT45212.2    AXCM01000253    AY349919    AAQ64870.1    ABLF02029217   
Pfam
PF13676   TIR_2        + More
PF13855   LRR_8
PF01582   TIR
PF13306   LRR_5
PF00560   LRR_1
PF01462   LRRNT
PF01463   LRRCT
Interpro
IPR035897   Toll_tir_struct_dom_sf        + More
IPR032675   LRR_dom_sf       
IPR000157   TIR_dom       
IPR001611   Leu-rich_rpt       
IPR003591   Leu-rich_rpt_typical-subtyp       
IPR000483   Cys-rich_flank_reg_C       
IPR026906   LRR_5       
IPR000372   LRRNT       
SUPFAM
SSF52200   SSF52200       
Gene 3D
PDB
1O77     E-value=2.42274e-14,     Score=193

Ontologies

Topology

Subcellular location
Cell membrane   In the fat body, detected in puntate structures along the cell periphery. Becomes evenly distributed in the cytoplasm 1 hour after bacterial infection.   With evidence from 11 publications.
Cytoplasm   In the fat body, detected in puntate structures along the cell periphery. Becomes evenly distributed in the cytoplasm 1 hour after bacterial infection.   With evidence from 11 publications.
Length:
531
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
19.68036
Exp number, first 60 AAs:
0.00964
Total prob of N-in:
0.22389
outside
1  -  312
TMhelix
313  -  335
inside
336  -  531
 
 

Population Genetic Test Statistics

Pi
178.993261
Theta
171.854406
Tajima's D
1.167203
CLR
0.366363
CSRT
0.709414529273536
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号