SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08151  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA014370
Annotation
PREDICTED:_protein_toll-like_isoform_X1_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.262 Extracellular   Reliability : 1.265 PlasmaMembrane   Reliability : 1.159
 

Sequence

CDS
ATGCGCCTGCTGCTGATGGCGCTGTGTGCGTGGTGGCTGCGTCCCGGTGTGCAGGCAGCGCGGCCCGCGTGCGGCCGGGCCCGGGACTGCGTCGCGGGACACCATCTCAACGATGAGTTCTTCTTCACTGTGCACGGTCAGAACCTAGTGATAAACTTCTCGGAGGCTCAGTATGTGGAGCTGGAGTGTCCCGAGGGCGTGGCGCTGGGCGGTGCGGGGATGCCGTCGTTCGACGGCGGCGCGCGCGTCCTCAACGTGACGCTTCGAAGGTGCAGCATCGGAGCCGACTCGCTGGCGGACGCTCTCGGAGCCCTCAACATCTCCGTCCTCGAGCGCCTGTCCCTCAAGGACACGCCGCCCGGCTCGCTCTCCGCGCTGCACCTGCGGGGCCTCGAGCACCTCTTGCGACTTGACCTCGAAGGGACCAGAGGCATGCCTCTCAGGGTCGAGGCTGGTGCTTTGCTGCCTCTCGTCAACTTGCGTATGCTGCAGCTCAACCGCGTGCAGATGGCGTCCCTACAATTTCCGCCAACGTTGCATTCGCTCCAGCTTTGGTTTGTCGGTGAGACGCGATTAGATCTAAGCGGTCTCGATCAGCTGCGAGCCCTCGTGGTGCACGAAAAGGAATCAGTGACGGTGAGCGCGTTGACGGCTGGCTCGTTGGAGAGCGTGGTGCTAGACGCGAGGAGGGTGTCGTTTCCGGCGGCGTCCAGGCCGCGCTCGATTCGACGTCTCGTGCTCGTGAACTGGAACGAGACGGACCTCTCCGCGCGGTGTGACGACGTGGAGCTGCTGCAGCTGCGAGGCTGGGTCGGCGAGGAGCCGGCTCCCCCCCGTAGATGGTTATCGCACTGTAAAAAGTTGCGCGAGTTTCGAATGAGCTTCGCTCGTCAGAAGTCTGTGACTCCCGGTCTGCTGGACGGCGCAGAAAATCTCGAAGATCTAGGTCTCACTTCCTGCCAGATTGACACATTACCTGTTGATCTCTTTAAGGAGAATAGAAATCTGCGGATCATTGATTTATCCCACAACAAACTACAAACATTACCAAGTGGCTTATTTTCGAACTTACGGAACCTGAAAGAACTCAATCTATCCAACAACAAGCTGCAGGCGGCGGCTGTGGGGACTCTGGGCTCGCTAGTCTCCCTACAGGATCTCAATCTTTCCCACAACCCGCCTCTACTTGATCTCTGCTCCGGTGGTTCTGATGCGTTCATCGTCTCTGGCACTTCCCCGCTAAAAGCGCTGACGGAGTTGGAAGAGCTCAGACTGGGTCACACGGGTGTGTCTCACGTGTGCAGCGACTGGCGAACCTCCATGAAGCAACTCCGTCTTCTCGATCTCTCCTACACAAACATCACCTCCCTGTCGTACCTGGATTTCCACTACGAGCACTCTGGATCCAAAGAGCTGACCGTGAACTTCAACGGCACGCCCGTCACCGAGCTCACCGTCGACGCGGGGAACTACAAGTCTGTGATCGCCGACCTGGCATCTGCATCGGTCAAGATAATATTGAGAGCAACTTTACCGTGCGACTGCTCGGACTACTGGACGGCACTGGCGTTCGGGGACCTCAGCACTCAAGCACAAGATTCCGTAGAGCTCCTGTGTAGGGAGGAGGAGCGTGGTTCACTAGCGGATGCGTTGGAACGGGAATCTCTGGAGTGTGCGGAATCGAGCCTGTGTGAGGACCAGGAGGGCTGCACTTGCTCCGTACGCCTTGACCTCTCGCTTGGTGTGGTGGCGACCGCGTCATGTGAGGGCGCGGGTCTGGACGAAATGCCATCGCGTCTGAAGTTCAAAGAGGCTCCCGTGTGGCGCTTAATGCTCGCCCACAACCACATCCAGACCGTTCGGCTTCAGGATCTGCCCGACACGATATTGGAGTTGGACCTGAGAAACAACTCTCTGCATAGATTGGACGGCCCGACTGCTTCGAAGTTATCAACTGTCCCTCTGTGGATCGCCAACAATTCGCTGGACTGCACATGTTACGGGTACGACTTGGTGACGAAGCTAGGACCTCATGTGCGCGACATGGAGCAAGCAACGTGCGACGACGGGACTTCTCTTAAAGAAGCACAGAATGGGGATCCCAGCGAATGTAGTTCAGCATTGGTCGTCGCCACGTCATTGATCAGCGCGCTGGCTTTGTTGGCAGTGATGGTCGCAGTTACAGCCGGCTGCGTGATGCGACCCGAGATGCGGCTTAGAATCAAGGTGCTGCTGCTGCGACTGGGCTGGTTGCCACGGCGGCCGGAGCCGGACGACGGGCGTCGGTTCGATGCATTCGTGTCGTACGCGCACGAGGACGAGGCGGTGGTGGAAGAGCTCGTGAAGCGGCTCGAAGTGGGGCACGGGTACCGGCTGTGCCTGCACTACCGCGACTGGGCGCCGGGCGAGTGGATCCACGTGCAGATCGCGGCCTCGGTGCAAGCGTCGCGCCGCACCCTTATCGTAGTCTCCCGGCACTTTCTGCGCTCCAAGTGGGCGCGCCAAGAGTTCCGTCAGGCACACGCGGCCGCGCTGCGTGACATCATACCGCGCCTCGTGCTGCTGTTCCTCGAGCCGCCGCACCGCTTGCCTCTCGACGCCGAGCTGCGCTCCTACATTAGGATCAACACCTACGTGCTCTGGACCGACCCCTGGTTCTGGCACAAACTAAAGCTAGCCCTGCCGCCCCCGCGCCTCCTCCCCACCCCGCTCGAGGATGTCTCCGTTAATAAGGCGGAGAGCTCCCCTCTCCACGGGGGGCAGGACACCAAGCCCTGCTCGCCCGAAGCCGAGACGGACACGTAG
Protein
MRLLLMALCAWWLRPGVQAARPACGRARDCVAGHHLNDEFFFTVHGQNLVINFSEAQYVELECPEGVALGGAGMPSFDGGARVLNVTLRRCSIGADSLADALGALNISVLERLSLKDTPPGSLSALHLRGLEHLLRLDLEGTRGMPLRVEAGALLPLVNLRMLQLNRVQMASLQFPPTLHSLQLWFVGETRLDLSGLDQLRALVVHEKESVTVSALTAGSLESVVLDARRVSFPAASRPRSIRRLVLVNWNETDLSARCDDVELLQLRGWVGEEPAPPRRWLSHCKKLREFRMSFARQKSVTPGLLDGAENLEDLGLTSCQIDTLPVDLFKENRNLRIIDLSHNKLQTLPSGLFSNLRNLKELNLSNNKLQAAAVGTLGSLVSLQDLNLSHNPPLLDLCSGGSDAFIVSGTSPLKALTELEELRLGHTGVSHVCSDWRTSMKQLRLLDLSYTNITSLSYLDFHYEHSGSKELTVNFNGTPVTELTVDAGNYKSVIADLASASVKIILRATLPCDCSDYWTALAFGDLSTQAQDSVELLCREEERGSLADALERESLECAESSLCEDQEGCTCSVRLDLSLGVVATASCEGAGLDEMPSRLKFKEAPVWRLMLAHNHIQTVRLQDLPDTILELDLRNNSLHRLDGPTASKLSTVPLWIANNSLDCTCYGYDLVTKLGPHVRDMEQATCDDGTSLKEAQNGDPSECSSALVVATSLISALALLAVMVAVTAGCVMRPEMRLRIKVLLLRLGWLPRRPEPDDGRRFDAFVSYAHEDEAVVEELVKRLEVGHGYRLCLHYRDWAPGEWIHVQIAASVQASRRTLIVVSRHFLRSKWARQEFRQAHAAALRDIIPRLVLLFLEPPHRLPLDAELRSYIRINTYVLWTDPWFWHKLKLALPPPRLLPTPLEDVSVNKAESSPLHGGQDTKPCSPEAETDT

Summary

Similarity
Belongs to the Toll-like receptor family.
EMBL
BABH01040360    BABH01040361    ODYU01007053    SOQ49485.1    EF442782    ABO21763.1    + More
AGBW02011129    OWR47184.1    GDKW01003048    JAI53547.1    GDHC01015553    GDHC01008551    JAQ03076.1    JAQ10078.1    GBHO01026374    GBHO01026373    GBHO01026372    GBHO01026370    JAG17230.1    JAG17231.1    JAG17232.1    JAG17234.1    ACPB03009442    KK855435    PTY22556.1    KQ435801    KOX73247.1    GFTR01008481    JAW07945.1    KQ979262    KYN22067.1    KK852931    KDR13629.1    KQ414914    KOC59528.1    KQ775195    OAD52269.1    KQ981880    KYN33933.1    GBYB01006639    GBYB01006641    GBYB01006643    JAG76406.1    JAG76408.1    JAG76410.1    GL887553    EGI70800.1    GFDF01000994    JAV13090.1    NEVH01013973    PNF28085.1    KK107356    QOIP01000010    EZA52048.1    RLU17569.1    CH964272    EDW83690.1    KZ288197    PBC33714.1    NNAY01000160    OXU30431.1    KQ434773    KZC03990.1    JRES01000062    KNC34506.1    GFDL01012744    JAV22301.1    ABLF02029217    GL447175    EFN86808.1    GFDL01012745    JAV22300.1    GFDL01012806    JAV22239.1    GFDL01012753    JAV22292.1    GFDL01012819    JAV22226.1    CH933806    EDW16578.1    GFDL01012754    JAV22291.1    AY124195    AAM97774.1    GFDL01012785    JAV22260.1    GFDL01012814    JAV22231.1    GFDL01012813    JAV22232.1    CH477452    EAT40665.1    CP012526    ALC46724.1    KJ188410    AHL39100.1    AXCM01000253    MH178390    QAT92918.1    DQ923424    ABK58729.1    KJ188411    AHL39101.1    NNAY01000105    OXU30928.1    KP274553    AJC98699.1    EF407561    ABQ59330.1    EU433386    ACC68670.1    CH940650    EDW67652.2    KRF83383.1    AY754607    AAX13182.1    KP274549    AJC98695.1    APCN01004779    APCN01004780    AY754609    AAX13184.1    L25390    AAA28942.1    GFXV01005058    MBW16863.1    AY349921    AAQ64872.1    AY349918    AAQ64869.1    CM000364    EDX14589.1    ATLV01025119    KE525369    KFB52194.1    EF117252    ABO38434.1    CM000070    EAL27102.2    JXUM01035187    JXUM01035188    JXUM01035189    GU014556    ADK55066.1    OUUW01000005    SPP81101.1    JXUM01035190    KQ561051    KXJ79871.1    AY349920    AAQ64871.1    AY349924    AAQ64875.1    JF895474    AEI25533.1    KP274533    KP274534    KP274535    KP274536    KP274537    KP274538    KP274539    KP274540    KP274541    KP274544    KP274551    AJC98679.1    AJC98680.1    AJC98681.1    AJC98682.1    AJC98683.1    AJC98684.1    AJC98685.1    AJC98686.1    AJC98687.1    AJC98690.1    AJC98697.1    AF444780    AAAB01008811    AAL37901.1    EAA45376.1    KP274552    AJC98698.1    KP274545    KP274548    KP274550    AJC98691.1    AJC98694.1    AJC98696.1    KP274542    AJC98688.1    KP274543    KP274546    AJC98689.1    AJC98692.1    AY349917    AAQ64868.1    CM000160    EDW98589.2    AY349922    AY349923    AAQ64873.1    AAQ64874.1    KP274547    AJC98693.1   
Pfam
PF13676   TIR_2        + More
PF13855   LRR_8
PF01582   TIR
PF13306   LRR_5
PF01462   LRRNT
PF00560   LRR_1
PF12366   Casc1
PF01463   LRRCT
Interpro
IPR000157   TIR_dom        + More
IPR001611   Leu-rich_rpt       
IPR032675   LRR_dom_sf       
IPR035897   Toll_tir_struct_dom_sf       
IPR003591   Leu-rich_rpt_typical-subtyp       
IPR000483   Cys-rich_flank_reg_C       
IPR026906   LRR_5       
IPR000372   LRRNT       
IPR022110   Casc1_domain       
SUPFAM
SSF52200   SSF52200       
Gene 3D
PDB
1O77     E-value=3.82716e-14,     Score=194

Ontologies

Topology

SignalP
Position:   1 - 19,         Likelihood:  0.998955
 
 
Length:
934
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
19.39852
Exp number, first 60 AAs:
0.00036
Total prob of N-in:
0.00053
outside
1  -  709
TMhelix
710  -  732
inside
733  -  934
 
 

Population Genetic Test Statistics

Pi
224.393299
Theta
188.131927
Tajima's D
0.617556
CLR
0.411275
CSRT
0.551322433878306
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号