SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08149
Pre Gene Modal
BGIBMGA012135
Annotation
Vacuolar_protein_sorting-associated_protein_13C_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 1.866
 

Sequence

CDS
ATGTTTTTAGAAAGATATCATGACTATGCAGTACTATTATTACAAGAAATAATGCCACGGGAGATTGCTTTTGATGGAACACTATCAATATGCAACCCTTGCTGGCTGAGATTTTATCGCGCAGTGCAAGTCCGGCCAGTAGACGATCCATTACCTCAGCAAGTTCAAGAACCATTACCCCAGCAAGTACAAGAAGAGGAAGTCCAAGAAATAGTAGTTGACGTTCAACAACAACAAGACATAGGTCTTATGACTATTCCTGGATATTTGCGTGTATCTAATACTGCTCGACGCTGTGTTTTTCAAAACTGCAGAAACGTACCAGCAAATGCTGTGCCAAAATATGTCAGGTTACATTTTTTTCGTATTAATAAGCTATTCATACCAAAACTTGCTCGAGTTTGCCAACCCCATATGATAAACAATGAATGGGAAGATCTACTTAATGAGCAAATACCTCTTCATGAAAACTTTAATAGTGCTCATGTTCTCGATATTATCGAGCTGTATGAATGGAGATTGGAACGAGGAACTCAGTTGGACTTCGAAAATGTTGAGGAGATAGATGACAATGAACTACATTTTTATACGGGTATGGATAAAATTCAATTCAATAATATTTTGAATCAAACATCTTCTCTACGTGATAGAACCAACAGTTCTGCTACTGTTTTGGGACTGTATTTAGTTAAAATAAGAACAGGTGAACCAGACGAGCGTATAGCTTCTATGTTTAATATGTCGAGAAGAACATTGGAACGAAAACTAAAAATAGCTCGAGAATGTTTATCTGAAGAGTTTGTTCCCCGCCATCTGGGTTTGGATCACATGACGAGAGAAGATGTAGTAGCTCGCAACTTAACCATCCCGAGTCATATTTTTGGAGGTAACCAGAATGAACCTGCGGCCATTCTTGTGTGTGATGGAACATACATATACGTGCAAAAAAGCTCCAACTTCCTTTTTCAGAGAAGAACGTATAGCCTGCACAAATTCCGCAACTTAATAAAACCCTTTTTAATTGTATGCACAGACGGCTATATTGTAGACGTATTAGGCCCGTATCCAGCTATTACTACGGATGCCGAAATAATGCGTCACATGATGGAGGAGGAAGTTTGGTATTGGTTTCTGAACGCCAACGATATTTTCATATTGGACCGCGGCTTTAGAGACTCTATCCCTGCCATCGAAGAGCATGGATATGATGCACATATGCCGCCAACAAGGACGAGAGGAGAGCAGTTGAGCACAGTAGATGCAAATAAATCACGTCTAATCACTATGTGTCGTTGGGTGGTAGAGACTATTAATGGTCGCTTTAAAAAAGACTTCAAAATATTCCGCCATGTTTATTTTAATGTAGCGCTTACAAATATGATGACTGATTTTAAAATAACTGCAGCACTTATCAATGCCACTTATCAGCCATATAGAGATAACGCTCATGCCGCAGAGTTTATAAATATAATAAATGAGAATATAAATAGAGAAAATGAATTGGCTGATTACGTGATTCGAAACAACTTAAACAGGCAAAGAGTTGCATTCACGCCGATAGAGGCAAACAATCCCGAATTAAGAGATTTTCCACAATTAACTTACGACGAGCTATTTTTATTTACCTTGGGAATATACCATTTGAAATTGGCCAAATCTTATTGCCATGAACACATGCGGCCAAACGGAGTGTATATAATGGAATTATACCATCGCAGAGAGTTGGTAGAAAATAAAATATTAATACGAGGCAGAATACAGTCTCGTCACATAAGAGCAAAACGCTATTATACATATATACTAATAAATCCGGCATTGCAAGGAAGACAAAGCCTCGAAGGGTATTACTGTTCCTGTATACACGGCCGCCGCACTGTAGGGAGTTGCGCGCACATCGCCAGTGTGGTATACTTTTTATCTTGGGCTATATATCAAGAAGAATTCCACGCACCTGCGGCGTTTTTAGACGAAACTCTTGTAGATTTGGATGCGGCAGAATAA
Protein
MFLERYHDYAVLLLQEIMPREIAFDGTLSICNPCWLRFYRAVQVRPVDDPLPQQVQEPLPQQVQEEEVQEIVVDVQQQQDIGLMTIPGYLRVSNTARRCVFQNCRNVPANAVPKYVRLHFFRINKLFIPKLARVCQPHMINNEWEDLLNEQIPLHENFNSAHVLDIIELYEWRLERGTQLDFENVEEIDDNELHFYTGMDKIQFNNILNQTSSLRDRTNSSATVLGLYLVKIRTGEPDERIASMFNMSRRTLERKLKIARECLSEEFVPRHLGLDHMTREDVVARNLTIPSHIFGGNQNEPAAILVCDGTYIYVQKSSNFLFQRRTYSLHKFRNLIKPFLIVCTDGYIVDVLGPYPAITTDAEIMRHMMEEEVWYWFLNANDIFILDRGFRDSIPAIEEHGYDAHMPPTRTRGEQLSTVDANKSRLITMCRWVVETINGRFKKDFKIFRHVYFNVALTNMMTDFKITAALINATYQPYRDNAHAAEFINIINENINRENELADYVIRNNLNRQRVAFTPIEANNPELRDFPQLTYDELFLFTLGIYHLKLAKSYCHEHMRPNGVYIMELYHRRELVENKILIRGRIQSRHIRAKRYYTYILINPALQGRQSLEGYYCSCIHGRRTVGSCAHIASVVYFLSWAIYQEEFHAPAAFLDETLVDLDAAE

Summary

EMBL
RSAL01000140    RVE46076.1    ODYU01002734    SOQ40606.1    RSAL01000093    RVE47928.1    + More
JTDY01002487    KOB71318.1    RSAL01000866    RVE41092.1    RSAL01000165    RVE45293.1    RSAL01003132    RVE40334.1    RSAL01000368    RVE42169.1    RSAL01000197    RVE44543.1    RSAL01005980    RVE39951.1    RSAL01000041    RVE50885.1    RSAL01000030    RVE51723.1    CAEY01000555    LBMM01016502    KMQ84404.1    NEDP02003062    OWF49584.1    JH817349    EKC43026.1    JH819060    EKC25484.1    CAEY01000034    LBMM01016052    KMQ84578.1    GL764207    EFZ18186.1    LNIX01000011    OXA49105.1    OXA49108.1    LNIX01000051    OXA37889.1    LNIX01000004    OXA56264.1    LNIX01000016    OXA46064.1    LNIX01000024    OXA42990.1    OXA48649.1    NSIT01000223    PJE78236.1    MUJZ01037002    OTF76533.1    GL766791    EFZ14590.1    LNIX01000032    OXA40694.1    KQ980825    KYN12427.1    LNIX01000001    OXA64651.1    LBMM01015392    KMQ84828.1    KQ979900    KYN18648.1    LNIX01000021    OXA43544.1    LNIX01000049    OXA37995.1    LNIX01000014    OXA46688.1    LNIX01000044    OXA38716.1    OXA38710.1    LBMM01015534    KMQ84768.1    LBMM01015464    KMQ84797.1    LNIX01000045    OXA38533.1    LNIX01000007    OXA52003.1    OXA55460.1    KQ979038    KYN23462.1    LNIX01000005    OXA54303.1    LNIX01000017    OXA45584.1    REGN01003993    RNA19707.1    LNIX01000015    OXA46405.1   
Pfam
PF13359   DDE_Tnp_4        + More
PF13613   HTH_Tnp_4
PF13843   DDE_Tnp_1_7
PF13855   LRR_8
Interpro
IPR027806   HARBI1_dom        + More
IPR007527   Znf_SWIM       
IPR029526   PGBD       
IPR027805   Transposase_HTH_dom       
IPR026847   VPS13       
IPR001611   Leu-rich_rpt       
IPR003591   Leu-rich_rpt_typical-subtyp       
IPR032675   LRR_dom_sf       
Gene 3D

Ontologies

Topology

Length:
666
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.60699
Exp number, first 60 AAs:
0.00118
Total prob of N-in:
0.00283
outside
1  -  666
 
 

Population Genetic Test Statistics

Pi
220.998066
Theta
45.599467
Tajima's D
1.575439
CLR
0.090971
CSRT
0.806159692015399
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号