SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08141  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA001085
Annotation
PREDICTED:_transient_receptor_potential-gamma_protein_[Bombyx_mori]
Full name
Transient receptor potential-gamma protein      
Alternative Name
Transient receptor potential cation channel gamma
Location in the cell
PlasmaMembrane   Reliability : 3.028
 

Sequence

CDS
ATGCTGTTGCAACAGCTGAGCAAAAGCGGCGCCTCCGAGATGTCCGGCGGCAGTGGCGGCGGCGGCTCCAGTGCTGACGGGCGGCGTCCCTCCACCTGCCGCGTGGACATGGGCGCGCTGCTGGCGTCCGAGCCGCGCCCGCTCGACAGCAAGGTTAAGCGGCACAGCATCCACGGGATGACGGAAGAAGAAAATGTGGTTCGACCACATCAGGAGATGGCCGTGCTGTCTTTGGAGGAGAAGAAGTACCTGCTGGGCGTGGAGCGAGGAGACGTGGCGGGGACGCGGCGCGTGCTGCAGCGGGCCCGCGACACCGGACACATCAACGTCGACTGTGTGGACCCGCTCGGACGCAGCGCGCTGCTCATGGCCATTGACAACGAGAACCTCGAGATGGTGGAGCTGCTCCTCGAGTTCGGCGTGGAGACCCGCGACGCACTGCTGCACGCCATCTCCGAGGAGTTCGTCGAGGCCGTGGAGGCCCTGCTCGACCACGAGGAGCGGACCAGGAAGCCCGGCGAACCGAACAGTTGGGAGGCGCTTCCGCCGGAGACGGCCACGTTTACGTCTGACATCACGCCGCTGATCCTGGCGGCGCACCGGGACAGCTACGAGATCATCAAGCTGCTGCTGGACCGCGGCGCGCAGCTGCCCGAGCCGCACGACGTGCGCTGCGGCTGCGACGACTGCGTGCGCTCCCGCCGCGAGGACTCGCTGCGACACTCCCGCTCCAGGATCAACGCGTACCGCGCGCTCGCCTCCCCTTCGCTCATCGCCCTATCCTCCAAGGACCCCATTTTAACCGCTTTCGAGCTGTCGTGGGAGCTGCGCCGGTTGTCCGCATTGGAACATGAGTTCAAAACGGAATACCAGGAGCTCCGCGTTCAGTGTCAGGAGTTCGCGACTGCACTGTTGGATCACACGCGGACGTCTAATGAACTTCAGATCCTGCTGAATCACGAGAAGGGTGCTTCACCTCAGGCACCGCTCACTGAACCAGGCGCTCCCGAGCGGATGCGCTTGTCGCGGCTCAAGCTTGCCATCAAGTTGCGACAAAAGAAGTTCGTGGCGCACCCGAACGTGCAGCAGCTGCTGGCGTCGATCTGGTACGAGAGCGTGCCCGGGTTCCGCCGCAAGAACATGCTGCTGCAGGCGGCGGAGATGGTGCGGATCGGCGCCATGTTCCCGCTCTACTCGCTCGCCTACATCGCGGCGCCGCACTCCGCCGTCGGACGCACGCTCAGGAAGCCCTTCATCAAATTCCTCTGCCACTCCGCCAGTTACTTTATGTTTCTATTTCTGTTGATCCTGGCGTCGCAGCGCATCGAGACGGCGCCGGGCGGGCTGCTGTGGGACGTCTCCCACGACGAGCCGCTCTCCCGGCGCGGCTCCATGCCCTCCATAGTCGAGTGGCTCATACTCGCCTGGGTCAGCGGCTTAATCTGGAGCGAAGTGAAGCAGCTGTGGGACATGGGGCTGAGAGAGTACGTACATGACATGTGGAACGTCATCGACTTCGTCACCAACTCGCTGTACGTGGCCACCGTGGCGCTCAGGATCGTCTCGCACTACCAGGTTCGTCGCGAGATGGCGATGGGCCTGCAGTGGAACCAACCTCGCGAGAAGTGGGACGCTTGGGACCCGATGCTGCTCTCCGAGGGGCTGTTCTCGGCCGCCAACATCTTCAGCAGTCTCAAGTTGGTGTACATCTTCAGCGTGAACCCTCACCTCGGTCCGTTGCAGGTGTCGCTGAGTCGGATGGTGTTGGACATCCTCAAGTTTTTTGTCTTGGACATACTCGTCATATTTGCGTTCTCATGCGGGCTAAACCAGTTGTTGTGGTACTACGCGGACATGGAGAAGAAGCGCTGCACGGTGGGCACCGCGCTCACGCCCAACGGCACCCTGCCCGACCCGGACGCCTGTGTCGTCTGGAGACGGTTTGCTAATTTGTTCGAGACAATGCAGACGCTGTTCTGGGCTGCGTTCGGGCTGGTGGACTTGGATTCGTTCGAGCTCGACGGGATCAAGATCTTCACGCGGTTCTGGGGGATGCTCATGTTCGGCACGTACGCCGTCATCAACGTCATCGTGCTGCTCAACTTGCTCATCGCCATGATGAACCACTCCTATCAGCTGATATCCGAGCGTGCAGATGTGGAATGGAAGTTCGCCCGCAGCAAGCTGTGGATCAGCTACTTTGAGGAGGGTGGAACTGCGCCCCCGCCCTTCAACGTGCTGCCCTCGCCCAAGTCCCTGCTGTACGCCTGGCGGTGGCTGCAGCGCCGGCTCTGTGGGCACGCCCGCGCCAAGCGAGAACATATGCGGACTATTAGGAGAAAGGTGAAGCAAGCCAATGAGAGAGACTTTCGATATCAGGCTATAATGCGGAACCTGGTGCGTCGCTACGTGACGGTCCAGCAGCGGCGCGCGGAGAGCGGCGGCGTCACCGAGGACGACGTCAACGAGATCAAGCAGGACGTCTCCGCCTTCCGCTGCGAGCTCGTCGAGATCCTGCGCAACTCCGGGATGAACACCTCCACAGCCAACGCGGGAGCTCCCGGCGGCGGAGGCGGCAAAAAGAATCGTCAGAAGGAGCGACGCCTCATGAAGGGATTCAACATAGCTCCGGGCGGGTCCCTGGCCCCCGTGGACGAGTTCATGTCGCCCGTGTCCTGGCTGCAGCACGACCACGGCGTGCCGCACTACTCGCTGTCCACGCTGCTCGGGCCGCGCCTGCGAGCCTCCCAGTCCAGCCTCAGCGACGGACCCGGCGCCGGGATGAGTGCGTCGCGTCGCAAGCCGCAGCACAAGCGTCGCTGGGGCACAATCATCGACGCCGCTCGGGCGGCCCGTGTGTCTCGACTCATCGGCCGGTCGCGCTCTGAGGACTCTGTCTGCGATCACGCGCGGCAGTCGCCAAGCGGTAGCGAGCCTTCGGAGTCGGGCAGCGACTCGCAGCGCAGTCCGGAGCGGACGGGATCTCGGAGTGGACCCTTGCATCCGTTGACGGCACTGGCGGCCCTCAAGCGGAAGCGAAAGAAATTCTCGGATTCCCGGCGGCCCGAAGCCACGGTCCGGCCCGTTCCGGCGCCTGAGAGTCTGCAGCGCGCCAGTTCGGTGCCGGCTCGCGTGCCCCCCGCCGCCCCGCCCCGCGCCCCTCCGCCGCCCGCCGTGTCGCCCTCCACCACCGCCGAGAGCGTGGCCGCGCGCGGAGGCAGCCGGGAGCCGCTGCTGGCCAGCCTCGACGACGAAGCGCACAAGCGGGACGGCTGCGGCCAGTGCGGGTACGAGTCGGGGCCGCAGGGCGGCGGGGAGGCGGGGGGCGGGGCGGGCGAGGCGGAGGGCGCGTGCGGGCGGTGCGCGGCGCTGGCGCGGCTGGCGGGCGTGACGCCGCTGGCGGGCCACGCGCCGCACCACTCCGCGGGCTGGCTCTAG
Protein
MLLQQLSKSGASEMSGGSGGGGSSADGRRPSTCRVDMGALLASEPRPLDSKVKRHSIHGMTEEENVVRPHQEMAVLSLEEKKYLLGVERGDVAGTRRVLQRARDTGHINVDCVDPLGRSALLMAIDNENLEMVELLLEFGVETRDALLHAISEEFVEAVEALLDHEERTRKPGEPNSWEALPPETATFTSDITPLILAAHRDSYEIIKLLLDRGAQLPEPHDVRCGCDDCVRSRREDSLRHSRSRINAYRALASPSLIALSSKDPILTAFELSWELRRLSALEHEFKTEYQELRVQCQEFATALLDHTRTSNELQILLNHEKGASPQAPLTEPGAPERMRLSRLKLAIKLRQKKFVAHPNVQQLLASIWYESVPGFRRKNMLLQAAEMVRIGAMFPLYSLAYIAAPHSAVGRTLRKPFIKFLCHSASYFMFLFLLILASQRIETAPGGLLWDVSHDEPLSRRGSMPSIVEWLILAWVSGLIWSEVKQLWDMGLREYVHDMWNVIDFVTNSLYVATVALRIVSHYQVRREMAMGLQWNQPREKWDAWDPMLLSEGLFSAANIFSSLKLVYIFSVNPHLGPLQVSLSRMVLDILKFFVLDILVIFAFSCGLNQLLWYYADMEKKRCTVGTALTPNGTLPDPDACVVWRRFANLFETMQTLFWAAFGLVDLDSFELDGIKIFTRFWGMLMFGTYAVINVIVLLNLLIAMMNHSYQLISERADVEWKFARSKLWISYFEEGGTAPPPFNVLPSPKSLLYAWRWLQRRLCGHARAKREHMRTIRRKVKQANERDFRYQAIMRNLVRRYVTVQQRRAESGGVTEDDVNEIKQDVSAFRCELVEILRNSGMNTSTANAGAPGGGGGKKNRQKERRLMKGFNIAPGGSLAPVDEFMSPVSWLQHDHGVPHYSLSTLLGPRLRASQSSLSDGPGAGMSASRRKPQHKRRWGTIIDAARAARVSRLIGRSRSEDSVCDHARQSPSGSEPSESGSDSQRSPERTGSRSGPLHPLTALAALKRKRKKFSDSRRPEATVRPVPAPESLQRASSVPARVPPAAPPRAPPPPAVSPSTTAESVAARGGSREPLLASLDDEAHKRDGCGQCGYESGPQGGGEAGGGAGEAEGACGRCAALARLAGVTPLAGHAPHHSAGWL

Summary

Description
A light-sensitive calcium channel that is required for inositide-mediated Ca(2+) entry in the retina during phospholipase C (PLC)-mediated phototransduction (By similarity). Forms a regulated cation channel when heteromultimerized with trpl.
Subunit
Interacts preferentially with trpl and interacts to a lower extent with trp.
Similarity
Belongs to the transient receptor (TC 1.A.4) family.
Belongs to the transient receptor (TC 1.A.4) family. STrpC subfamily.
Keywords
ANK repeat   Calcium   Calcium channel   Calcium transport   Complete proteome   Ion channel   Ion transport   Membrane   Reference proteome   Repeat   Sensory transduction   Transmembrane   Transmembrane helix   Transport   Vision  
Feature
chain  Transient receptor potential-gamma protein
EMBL
BABH01000036    BABH01000037    BABH01000038    AGBW02012175    OWR45522.1    ODYU01007315    + More
SOQ49990.1    NWSH01002346    PCG68478.1    KZ149891    PZC79051.1    AAAB01008964    KQ981855    KYN34835.1    APCN01000771    KQ976418    KYM89481.1    JTDY01004876    KOB67644.1    ADTU01001096    ADTU01001097    ADTU01001098    ADTU01001099    ADTU01001100    ADTU01001101    ADTU01001102    ADTU01001103    ADTU01001104    ADTU01001105    QOIP01000012    RLU16302.1    AXCN02000840    GL448228    EFN85066.1    CH477324    EAT43552.1    KQ980989    KYN10488.1    GGFM01000266    MBW21017.1    GGFL01004091    MBW68269.1    KK852631    KDR19850.1    EAA12444.4    KZ288192    PBC34293.1    GGFM01000262    MBW21013.1    GGFL01004093    MBW68271.1    GGFL01004092    MBW68270.1    AE014134    ACL83036.2    GGFK01000746    MBW34067.1    GGFJ01000823    MBW49964.1    FJ821029    ACN94674.1    CH479180    EDW29330.1    OUUW01000004    SPP79365.1    GAKP01004193    JAC54759.1    GANO01000663    JAB59208.1    CP012523    ALC40022.1    KX249690    AOR81467.1    JXJN01021148    JRES01000842    KNC27808.1    CM000158    KRJ99073.1    EDW90253.2    KRJ99074.1    CM002910    KMY90538.1    KMY90540.1    KMY90537.1    KMY90539.1    CH902620    EDV32537.2    KPU74022.1    KPU74023.1    AJ277967    AJ277968    CH954179    KQS62953.1    EDV56633.2    KQS62954.1    CH933807    EDW11668.2    KPU74021.1    CH379060    EAL33988.3    KRT04378.1    CH940649    EDW64400.2    CH964274    EDW85326.2    ACPB03022385    KQ414572    KOC71316.1    KQ435850    KOX70909.1    CH916379    EDV94187.1    GBYB01002525    JAG72292.1    AY387857    AAR26327.1    KQ982819    KYQ50204.1    GBYB01002524    JAG72291.1    EU649776    ACD69414.1    AAZO01001036    DS235053    EEB11063.1    LBMM01000754    KMQ97565.1    KK107488    EZA49892.1    GL444248    EFN61135.1    NEVH01020337    PNF21643.1    CCAG010018206    KQ434778    KZC04354.1    LNIX01000006    OXA52821.1    GL732578    EFX75016.1    GDIQ01019517    JAN75220.1    LRGB01001801    KZS10426.1    GDIP01033238    JAM70477.1    GDIQ01042893    JAN51844.1    GDIP01153419    JAJ69983.1    GDIQ01156296    GDIP01038044    JAK95429.1    JAM65671.1    GDIP01235625    JAI87776.1    KJ572528    AIA22827.1    MNPL01001084    OQR79469.1    ABJB010218724    ABJB010332204    ABJB010546725    ABJB011014079    DS679906    EEC04095.1    UFQT01002971    SSX34380.1    UFQT01000733    SSX26810.1   
Pfam
PF08344   TRP_2        + More
PF00520   Ion_trans
PF12796   Ank_2
PF00023   Ank
PF00005   ABC_tran
PF00664   ABC_membrane
Interpro
IPR020683   Ankyrin_rpt-contain_dom        + More
IPR036770   Ankyrin_rpt-contain_sf       
IPR005821   Ion_trans_dom       
IPR013555   TRP_dom       
IPR002153   TRPC_channel       
IPR002110   Ankyrin_rpt       
IPR003439   ABC_transporter-like       
IPR017871   ABC_transporter_CS       
IPR011527   ABC1_TM_dom       
IPR027417   P-loop_NTPase       
IPR036640   ABC1_TM_sf       
IPR003593   AAA+_ATPase       
SUPFAM
SSF48403   SSF48403        + More
SSF90123   SSF90123       
SSF52540   SSF52540       
Gene 3D
PDB
5Z96     E-value=0,     Score=1787

Ontologies

Topology

Subcellular location
Membrane  
Length:
1145
Number of predicted TMHs:
6
Exp number of AAs in TMHs:
130.89921
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00796
outside
1  -  388
TMhelix
389  -  411
inside
412  -  417
TMhelix
418  -  440
outside
441  -  499
TMhelix
500  -  522
inside
523  -  549
TMhelix
550  -  572
outside
573  -  593
TMhelix
594  -  616
inside
617  -  681
TMhelix
682  -  704
outside
705  -  1145
 
 

Population Genetic Test Statistics

Pi
1.430578
Theta
5.058776
Tajima's D
-1.949945
CLR
629.851816
CSRT
0.0138993050347483
Interpretation
Possibly Positive selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
31250652 VLDILKFFVLDILVIFAFSCGAGMSASR 100.00 1e-08
31250652 HHGCLLSGSTVIHQNQR 100.00 6e-08
31250652 MVLDILKFFVLDILVIFAFSCGAGMSASR 100.00 7e-08
31250652 MVLDILKFFVLDILVIFAFSCEVMMLR 100.00 0.003
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号