SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08125
Pre Gene Modal
BGIBMGA012813
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.467
 

Sequence

CDS
ATGGATGGAAGGCCAAACGTACGGAAGCTTGCTGAGCCCGACACACGAGCGAAGACCCACACCGCTATTAATCAATGGGCCAACGATCGTCGCACTGAAACCACTGCCTCTGACCTCGACACGTGGACTAGTCTAAAGCGAAGTGTAAAAGATATATGTCACCAATACCTCCAACCATCACAACTGGTCAAAAAACAAGATTGGATGACAGATTCAATTTTGCAGCTTATGGAAGACAGGAGGCAATTTAAGGGTACAAATCCAGTAATGTATAAGCAAATCGATGTCACCATTCGAAAAGAGATTGCGAAAGCCAAGAATGATTACTACAGCAATAAGTGCGCGCACTTGGAAGATCTCCTTCGTAAACATGACAGCTTCAATGCGCACAAGCACATCAAGGAAATGGTTGGTCATAGACGGAAATCAATGAATACTCTGACCGATGCAGGTGGGAACCTCATTCTTGACACCGATGGCAAAAAGAGAGTGTGGTGTGACTATGTTGCAGAGATGTTTGCGGACTCATCGAGGAACATTTCACCGATCACTGATCGTAATGGTCCAGCTATGTTGCGATCTGAGGTTTTGCGGGCCTTGAAAGCTGCTAAAACAGGTAAATCACCGGGTCCTGATAATATACCGATCGAAATACTAAAGTTGCTGGAAGAAGATCAACTGGACGTTCTCACAGAGTTCTTCAACAACATCTACGAAACAGGCAATCTTCCTAGTGACTGGCTAAAATCCACATTCATCACGATACCCAAGAAGCAAAATGCCAAAAAATGTGGAGAGTATCGTATGATTAGTCTGATGAGCCATGTCCTAAAAGTATTCTTGAACATCATACAGAATAGAATACGGCCAAAATGTGATGAACAACTGGGCGATAGCCAATTTGGATTTCGATCTGGTGTTGGCACCAGAGAAGCTCTTTTCGCTCTCAACGTTCTCGTACAGAAATGCAGAGACATGCAAACTGATGTCTTTTTGTGCTTCATAGACTACGAAAAGGCATTTGACCGAGTTAAACATCATCAACTTTTTAGCCTTTTATGTGACATTGGTCTAGATGAGGCTGTGATGTCAAAAGCTCTTGAAAATCTTGAAGTGGGAATAGGAATCAACGGCAGGGTCGTTAACAACTTGCGTTATGCGGACGACACTATCCTTATTGCAGCATCGGAAGCCGATTTGCAAGCAATTGTGAATAAGGTTAATGAGTGCAGCGAAGAAGCCGGGTTGTCGATAAACATAAACAAGACCAAGTTCATGGTAGTCTCAAGAAACCCGGATTTGAGTTCAAGCGTATCTGTAGCTGGGAAACAACTAGAGCGGGTACGACAGTACAAGTATTTAGGGGCTTGGGTAAACGAAGCATGGGAATCTGATCAAGAAATCAAGACCCGGATAGAAACTGCTCGAGCCTCTTTTAATAAAATGAGGAAAGTTCTTTGCTGTCGTCAACTGAATATAAAGCTCCGAGTCAGGCTACTCATGTGCTATATCTGGCCTATCGTCATGTATGGTTGCGAAACGTGGACCCTGAAAGAGGACACTACAAGACGCCTACAGGCATTCGAGATGTGGTGCTACCGTCGCATGTTACGCATTGGTTGGACGCAGAGGATACGTACTTGGCACGTGTTGAGAAACGACTATGGATTAGGAACAGATTATGATTACCTCACATGGGCAGGTAAGCGGTGGTATTGTGACTTCTATCTTGACGCAGTAACGAATACCAACTAA
Protein
MDGRPNVRKLAEPDTRAKTHTAINQWANDRRTETTASDLDTWTSLKRSVKDICHQYLQPSQLVKKQDWMTDSILQLMEDRRQFKGTNPVMYKQIDVTIRKEIAKAKNDYYSNKCAHLEDLLRKHDSFNAHKHIKEMVGHRRKSMNTLTDAGGNLILDTDGKKRVWCDYVAEMFADSSRNISPITDRNGPAMLRSEVLRALKAAKTGKSPGPDNIPIEILKLLEEDQLDVLTEFFNNIYETGNLPSDWLKSTFITIPKKQNAKKCGEYRMISLMSHVLKVFLNIIQNRIRPKCDEQLGDSQFGFRSGVGTREALFALNVLVQKCRDMQTDVFLCFIDYEKAFDRVKHHQLFSLLCDIGLDEAVMSKALENLEVGIGINGRVVNNLRYADDTILIAASEADLQAIVNKVNECSEEAGLSININKTKFMVVSRNPDLSSSVSVAGKQLERVRQYKYLGAWVNEAWESDQEIKTRIETARASFNKMRKVLCCRQLNIKLRVRLLMCYIWPIVMYGCETWTLKEDTTRRLQAFEMWCYRRMLRIGWTQRIRTWHVLRNDYGLGTDYDYLTWAGKRWYCDFYLDAVTNTN

Summary

EMBL
GU815089    ADF18552.1    NWSH01001998    PCG69477.1    LBMM01001656    KMQ95932.1    + More
GGMS01004979    MBY74182.1    AAGJ04160952    RQTK01000700    RUS75926.1    BDOT01000090    GCF50888.1    BDOT01000005    GCF41419.1    BDSA01000081    GBE63537.1    BDOT01000002    GCF39993.1    BDOT01000017    GCF44637.1    GCF44634.1    BDOT01000056    GCF48696.1    BDOT01000150    GCF53027.1    GCF53030.1    BDOT01000039    GCF47373.1    GCF40210.1    NCKU01003098    RWS08177.1    BDOT01000006    GCF41910.1    GCF41584.1    GCF40259.1    GGMR01018096    MBY30715.1    BDOT01000054    GCF48631.1    BDOT01000183    GCF53956.1    NEVH01007834    PNF34995.1    GCF48586.1    BDOT01000038    GCF47332.1    BDOT01000077    GCF50202.1    GCF48632.1    NEVH01025130    PNF15934.1    GCF41464.1    GCF50924.1    BDOT01000049    GCF48208.1    GCF47275.1    BDOT01000018    GCF44752.1    NEVH01002150    PNF42436.1    NEVH01002690    PNF41636.1    QIAP01000240    PYX61602.1    NEVH01013208    PNF29772.1    BDOT01000101    GCF51279.1    NEVH01006981    PNF36299.1    NEVH01007822    PNF35313.1    NEVH01006734    PNF36732.1    NEVH01024952    PNF16338.1    NEVH01013241    PNF29590.1    BDOT01000094    GCF51020.1    BDOT01000165    GCF53431.1    NEVH01002684    PNF41680.1    NEVH01000609    PNF43402.1    NEVH01020333    PNF21790.1    NEVH01007402    PNF35873.1    NEVH01012564    PNF30212.1    PNF16321.1    NEVH01006936    PNF36357.1    NEVH01011205    PNF31711.1    NEVH01012083    PNF30919.1    NEVH01005896    PNF38212.1    NEVH01027104    PNF13657.1    PNF38208.1    NEVH01026085    PNF14968.1    NEVH01016289    PNF26277.1    NEVH01017540    PNF24056.1    NEVH01027067    PNF13944.1    NEVH01020851    NEVH01013954    NEVH01006574    NEVH01001358    NEVH01001354    PNF21237.1    PNF28332.1    PNF37782.1    PNF42792.1    PNF42884.1    NEVH01015309    PNF27009.1    NEVH01013215    PNF29703.1    NEVH01022636    PNF18588.1    PNF37787.1    NEVH01005906    PNF38146.1    NEVH01020940    PNF20478.1    NEVH01023953    PNF17877.1    NEVH01019075    PNF22938.1    NEVH01005889    PNF38332.1    NEVH01016335    NEVH01006721    PNF25462.1    PNF37115.1    NEVH01011186    PNF32183.1    NEVH01024428    NEVH01017533    NEVH01016946    NEVH01015820    NEVH01015300    NEVH01013960    NEVH01010478    NEVH01010477    NEVH01005894    NEVH01003749    NEVH01003737    NEVH01000598    PNF17088.1    PNF24133.1    PNF25000.1    PNF26655.1    PNF27272.1    PNF28247.1    PNF32492.1    PNF32520.1    PNF37274.1    PNF38220.1    PNF40102.1    PNF40402.1    PNF43530.1    NEVH01002700    PNF41535.1    NEVH01020850    PNF21258.1    PNF37211.1    NEVH01013563    PNF28562.1    NEVH01003500    PNF40666.1    PNF37310.1    BDOT01000008    GCF42705.1    NEVH01021921    PNF19488.1    NEVH01013553    PNF28765.1    NEVH01013959    PNF28275.1    NEVH01019077    PNF22889.1    BDOT01000105    GCF51450.1    NEVH01017460    PNF24248.1    KF881087    AIJ27486.1    NEVH01014359    PNF27813.1    AFYH01119920    GCF44732.1    NEVH01020937    PNF20581.1    NEVH01021219    PNF19787.1    NEVH01005277    PNF39212.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF00168   C2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR030431   FAM189       
IPR035892   C2_domain_sf       
IPR000008   C2_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
5HHL     E-value=2.00796e-05,     Score=116

Ontologies

Topology

Length:
584
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.3938
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00381
outside
1  -  584
 
 

Population Genetic Test Statistics

Pi
13.161156
Theta
20.139835
Tajima's D
-0.979787
CLR
55.34816
CSRT
0.137293135343233
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号