SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08124
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Papilio_xuthus]
Location in the cell
PlasmaMembrane   Reliability : 2.703
 

Sequence

CDS
ATGGTACGTAACCGGAAAGTAGTGTTTGGTCTATTGAATGCAGGCTCTTTGTCTACAAATCGGGACGAATTTCTTTTGGCCATGGCTCGCCATTCTGTTGACGTTATGGCTATAAACGAGACTTGGCTTAGGTTTGGGGAGGAGGGCCGTGCACCTTGTGTGCCAGGGTACAGACTCAAGCATGTTCCTCGACCAGTTAGTATAAGGGGTGGTCGTGGTGGCGGGGTGGCCTTTTATCTCAGAGCTGATATAAGTGCTCGGGTGTGTATGCACCCCGGACATTTGGATGTTGAACAGTTGTGGATAACAGTGAATTTTTGCGGGAAAAAGCTATTAATAGGCACTGCATATCGCCCCCCTTGGTCTGATCTGGAAAATTTCCTAGAGGGACTGACCGAAAGTATTGGTGCTATGGCTCCTTATGACAATATAGTACTTCTCGGAGATTTTAATGTAAACCTATTGGACTGTAATTGTTCTAGAACAAAAAAAATAAATGAATTTCTAAGCCACTTCAGTCTCTCGCAAATAGTAAGGACTGCAACACACTTTATGAGTGGTAGTAGTACTCTGTTGGATGTTATTTGTACTGACATTGGCATTAATGATGTCGGGGTTGATTATATTCCCGAGCTTGGCCACCATGCTTTTGTCACATGTGAGACTTTGATCCGAAAGGAAAGACCAATGTCTAGAATGATCACTTCCCGTCAATTTAAGAATATCTTGGAGGAGTTCTTTACTCAGGATCTAAATACAATACCCTGGTCGAACATCGCCCTCCTGGATGACGTTGACACGATGGTTTACACCTTTTCTACGTTTATTCTGTACCTGTACGACCTCCATGCTCCGCTCAAAACCCTGAAATTCAAAACACGTTCCACTCCTTGGATTACTGATAATGTTCGATTATTGTTTAAATTGCGAGATGCTGCACGCTATAGATCACATGTAACTCAGGTTCATAGTCATAAACAGTATTATTTAGACCTTAAGAAGCAGGCAGCTAGCGTCTTAGCATCGGAAAAAAAGACCTACTACAACAATTATATTAATAGCAACTTCGGAAACCCTAAAAAGTTATGGAAAAATCTGAAATCTGATGTGATTCCGTCACATCAGGAGAAAGCATTGCCTGAACACCTTAATGACGCTAATGCTATCAATGATGCTTTTCTGGATGTACCCGGGGTCTGTAGTTCTGACGTTTCAGGATACTCATTCTTTGAGTATTCTAACACATCTCCAAAGTTTACGCTTAAAACTGTCAACCAGGATACGGTTCTTAAGATTATTAACAGCATTAAATCCAACGCTCAAGGCATTGACGGAATAAGCGGTGAGATGATATCGCTCTCACTGCCTTCAACATTGGAGGCGATTACTAGCATTATCAATAAGTCCATTGATACAAATACGTTTCCTGCTCAGTGGCGATGTTCTGTGGTTAGCCCTATTCCGAAAGTCACGCACCCTCAAGCTTTTAAAGATCTTAGGCCTATTAGTGTGTTGCCTTTTCTGTCCAAGATCTTGGAGAAGGTAGTTTACTCACAGGTAGCAGCATATATCGAATCAAATAACATTCTTCCAGTGTTTCAATCGGGTTTCAGAAAAAGCCGAGGAACGGCCGCTGCTCTTACTGACATTGTGGGTAATATTCTCGAGGCTCGTGACAGGAGCCAGGGTACGATACTGACGCTGCTGGATTTCTCACGGGCTTTTGATACAATTAACACTGCCTTACTCTTAGCAAAATTAACTCACTATGGGTTCTCTGATAATGCTGTGCAATGGTTTAGCAGTTATATGTCGAGTAGAACGCAATTTGTACAGATACGGAAAGAAGATGGAACTAAACTAACCTCTACTTCTAAGCCGATTACTAGAGGCGTTCCCCAAGGTTCTGTCCTGGGACCATTGTTGTTTATTTTGTACAGTGCAGATATCACTCAGTGTTTCAAGAATTGTAAATACCATATTTATGCTGACGATGTACAATTATACCACTCTTTTGATGTTGGAGATACCCCTTCTGCTGTCAGTTTTATCAATGGGGATCTGCAGAGGATTGTCTCTTGGTCTGAACAGAATTCCTTAGTATTGAACCCCTCTAAGTCTAAATACATGATACTAGGCAGTAAATCTCAGATAGCAAAGATTTTATCACTCGATCCTAAGACTGAAGATTCTCTACTCGTTTAG
Protein
MVRNRKVVFGLLNAGSLSTNRDEFLLAMARHSVDVMAINETWLRFGEEGRAPCVPGYRLKHVPRPVSIRGGRGGGVAFYLRADISARVCMHPGHLDVEQLWITVNFCGKKLLIGTAYRPPWSDLENFLEGLTESIGAMAPYDNIVLLGDFNVNLLDCNCSRTKKINEFLSHFSLSQIVRTATHFMSGSSTLLDVICTDIGINDVGVDYIPELGHHAFVTCETLIRKERPMSRMITSRQFKNILEEFFTQDLNTIPWSNIALLDDVDTMVYTFSTFILYLYDLHAPLKTLKFKTRSTPWITDNVRLLFKLRDAARYRSHVTQVHSHKQYYLDLKKQAASVLASEKKTYYNNYINSNFGNPKKLWKNLKSDVIPSHQEKALPEHLNDANAINDAFLDVPGVCSSDVSGYSFFEYSNTSPKFTLKTVNQDTVLKIINSIKSNAQGIDGISGEMISLSLPSTLEAITSIINKSIDTNTFPAQWRCSVVSPIPKVTHPQAFKDLRPISVLPFLSKILEKVVYSQVAAYIESNNILPVFQSGFRKSRGTAAALTDIVGNILEARDRSQGTILTLLDFSRAFDTINTALLLAKLTHYGFSDNAVQWFSSYMSSRTQFVQIRKEDGTKLTSTSKPITRGVPQGSVLGPLLFILYSADITQCFKNCKYHIYADDVQLYHSFDVGDTPSAVSFINGDLQRIVSWSEQNSLVLNPSKSKYMILGSKSQIAKILSLDPKTEDSLLV

Summary

EMBL
NWSH01006271    PCG63543.1    KZ150070    PZC74075.1    NWSH01000998    PCG73165.1    + More
NWSH01000010    PCG80923.1    NWSH01001817    PCG70032.1    GEZM01051381    GEZM01051380    JAV74995.1    GEZM01041318    GEZM01041317    JAV80524.1    DNUT01000507    HBI41157.1    GEZM01045590    GEZM01045589    JAV77734.1    DMQF01000361    HAO15230.1    DMQF01000352    HAO15199.1    GEBQ01020572    JAT19405.1    GEZM01074146    JAV64657.1    GEBQ01006447    JAT33530.1    GEZM01007604    JAV95063.1    LSMT01000554    PFX16333.1    GEZM01074147    JAV64656.1    LBMM01010997    KMQ87090.1    DMQF01000030    HAO14052.1    DNUT01000056    HBI39512.1    GEZM01008907    JAV94684.1    GEZM01000581    JAV98361.1    GEZM01061184    JAV70703.1    GEZM01061183    JAV70704.1    LSMT01000121    PFX26660.1    LBMM01014048    KMQ85356.1    GANO01004066    JAB55805.1    DNUT01000451    HBI40968.1    GANO01004094    JAB55777.1    DMQF01000003    HAO13943.1    NWSH01000817    PCG74070.1    GEZM01061182    JAV70705.1    GEZM01061185    JAV70702.1    DMQF01000478    HAO15711.1    DNUT01000170    HBI39961.1    DNUT01000374    HBI40695.1    GANO01004275    JAB55596.1    GBHO01012041    GBHO01012038    JAG31563.1    JAG31566.1    LSMT01000044    PFX30840.1    LSMT01001965    PFX11729.1    QNYJ01000098    RUA05525.1    GDRN01075630    GDRN01075629    JAI63022.1    GAMC01021037    GAMC01021036    JAB85519.1    LSMT01000021    PFX32582.1    GFDF01007660    JAV06424.1    DNUT01000297    HBI40414.1    DMQF01000157    HAO14486.1    GEHC01000940    JAV46705.1    QNXQ01000100    RUM30450.1    QNYJ01000080    RUA05885.1    GEHC01000909    JAV46736.1    GEHC01000896    JAV46749.1    GANO01001936    JAB57935.1    GANO01004238    JAB55633.1    HAEI01014175    SBS16644.1    GAMC01021038    GAMC01021033    GAMC01021031    JAB85522.1    GANO01004338    JAB55533.1    GANO01004361    JAB55510.1    GANO01004070    JAB55801.1    GANO01003893    JAB55978.1    QNYJ01000077    RUA05978.1    RJVU01061422    ROJ36303.1    LBMM01017805    KMQ83966.1    HAEG01006811    SBR77686.1    GEHC01000892    JAV46753.1    RSAL01001570    RVE40758.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF18701   DUF5641
PF05380   Peptidase_A17
PF00665   rve
PF17917   RT_RNaseH
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR011011   Znf_FYVE_PHD       
IPR021109   Peptidase_aspartic_dom_sf       
IPR040676   DUF5641       
IPR041373   RT_RNaseH       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57903   SSF57903       
SSF53098   SSF53098       
SSF50630   SSF50630       
Gene 3D
PDB
6AR3     E-value=2.45416e-05,     Score=117

Ontologies

Topology

Length:
734
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.18846
Exp number, first 60 AAs:
0.0354400000000001
Total prob of N-in:
0.00430
outside
1  -  734
 
 

Population Genetic Test Statistics

Pi
2.825263
Theta
2.968555
Tajima's D
-0.510349
CLR
29.14629
CSRT
0.247887605619719
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号