SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08123
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.864
 

Sequence

CDS
ATGTGTTCAATTAGAATAAAAGGTAAATTTCAAAACTACACAATTATTAACGTACATGCCCCAACGGAGGAAAGCGCCCCAGAAGAGAAAGAGAAGTGGTACTATAATGTGGAAAGTGTGTACTCTAAAGCGCCCAAAGGTGACGTTAAGGTAATAATAGGAGATCTAAATGCGAAAATTGGCCGAGAAGAGGTATACTGTCCAACAATTGGACTACATAGTCTCCACGAAACCTCCAATGATAACGGCACCCGACTTATTGACCTTGCTTCATCTTTGAATATGGCTATTGGAAGTACATGTTTTCCGCACAAAAACATACACAAAGTTACTTGGTTTTCCGCTGACGGGGTTACCCGTAACCAAATTGACCATATTTTGATTGACCGTAGATATTACTCAAACCTCCTGGACGTTAGGAGCCACAGAGGTGCCAACATAGATTCGGACCACTATTTAGTCGTTTGCAAAATGAGGGCAAGAATATCGCAATACAAGTACACCAAGACTGTTAGGACAAGAAAGTTTGACACCTCAAAGTTAAAGCGACGGCCAGGGGTGAACTCTGAGTACATTGAGTGTGTGGGCCAAGAACTGGATAAGATAACAGATAATAGAAATAGTAATGTAGATTCTGATGAAATATGGCAACGCCTGAAATCTGCAGTTACAACAGCAGCTACGAAAGTTCTTGGACACGAAGAAAAGCGAAAACGGAATGGGTGGTTCGACGATGAATGCCAAAAAGTCACAGATGCGAAGAATAAGGCTCATAAATTATTGCAGCAAAAACTCACTCGGTGCCGTAGAGAGAATTACAGAAACCTTAGGATTAAAGAAAAACAGCTACACAAAAGGAAGAAACGAATGTTTGAAGAGCAACAACTTAAGGAAATTGCAAATAGTTACTCAAAGCAGGAATCCAGGATTTTCTACAAGCAAGTGAATAGCGGAAAGAAGGAATTTAAACCAAGAACCTCAGCCTGTAGAAATAAAGATGGCCAACTGCTTAATGACAGAACAGAAGTCATTAAAAGGTGGGCAGAACACTTCCAAGAGCTACTAAACAAACCATCAGTTGCTACTCATATCGATGAAGTCGAAGCTCCACTTAATCATCAGTGGCTAGAAGTGTCCCAACCGTCTCTGGAAGACACCAGAGCTGCCAGCCAAAAACTCAAAAACAATAAAGCTCCAGGAAACGACAACATCCAGAGTGAACTGCTGAAATACGCTGGGTCCCAGTTTGAAGAGGAATTCCATAAACTAGTACTGCAGATATGGAATTCTGAAGTTATGCCTGAGGAATGGAACACAGCGGTTATTTGTCCTCTCCACAAGAAGGGCGATGTTCTCGACTGTCAGAACTATCGAGGCATTTCACTCCTCAATACAGCATATAAGATATTTGCGAACGTTCTCTTTGGCAAATTAAAACCTTTCGTGGAGCCTAGACTAGGAGAATATCAGTGTGGTTTCCGACCTGGTAGATCAACCATCGACCAAATCTTCTCCCTACGACAAATACTTGAAAAAACTCTTGAATTTAATGCTGATACGTATCACCTTTTTATTGATTTTAAAGCTGCCTACGACAACATAAGCCGTGATTTCCTATACCAGGCTATGCATGAGATTGGCGTACCACCGAAGCTTATATCTTTAACAAGGATGACACTGGTTGCATCGCAAAGCATTGTTAAGATCCAAACAGACCTATCGGATCCTTTTAGAACCCATGATGGACTAAGGCAGGGTGATGCCCTCTCCTGCCTTCTTTTCAATGTTGCACTCGACAAGTGTATCCGTGACTCAGCAATAGAGACGACGGGCAATATATATTACAAATCCGCTCAAGTACTGGGATATGCGGATGATATTGACGTCATTGGCAGATCAGCTCTCGCAGTAGAAAGTGCGTACCTTGCTCTCGAGGCCTCGTCTCTCGAAGCCGGTCTCCAAGTAAACGCAGACAAAACTAAATTCCTGAGGGTGTCGAGGGACTTACGTGAGGACACAGCGCATAAAAATATTGGCCAGCATACTTTTGGATCTGTGAATGAATTTGTATATCTTGGTTCTCTGATAACGAATAATAATAATATAACAGCAGAAATAGTTAAGAGAATACTGTCGGCGAATAAATGCTACTTCGGCCTGCTTAAATATTTCTGTTCCAAAATTCTGTCACGAAATATCAAAATTATTTTATACAAGACCCTACTGAGGCCCATTCTTATTTATGGCTCAGAGACATGGGTACTCAGCAAAAAAGATGAGAACCGTCTACTTGTGTTCGAGCGTAAGATTCTAAGACGGATATTCGGTGCTGTGCGGGAAAACGAGATATGGAGGACGCGCTATAACCACGAGTTGTATGATGTTTACAAAGATCCTAACATCATAACAACTATAAAGATTGGACGCCTACGATGGGCAGGACATGTGGTTCGAATGGAGAGTACCAGAATGCCAAGACAATTGCTCTATGGCAAACCAGAGGGCCGCAGAAGTCGTGGCAGACCCAAACTTCGATGGTTGGATGGCGTGGAGCGCGACCTCAAAAATATCGGCGTCAAGAACTGGAAGGAGAAAGCCCTGAACAGAGCAGTCTGGAGAAACATACTGGACCAGGCTAAGGCCCACCCTGGGCTGTAA
Protein
MCSIRIKGKFQNYTIINVHAPTEESAPEEKEKWYYNVESVYSKAPKGDVKVIIGDLNAKIGREEVYCPTIGLHSLHETSNDNGTRLIDLASSLNMAIGSTCFPHKNIHKVTWFSADGVTRNQIDHILIDRRYYSNLLDVRSHRGANIDSDHYLVVCKMRARISQYKYTKTVRTRKFDTSKLKRRPGVNSEYIECVGQELDKITDNRNSNVDSDEIWQRLKSAVTTAATKVLGHEEKRKRNGWFDDECQKVTDAKNKAHKLLQQKLTRCRRENYRNLRIKEKQLHKRKKRMFEEQQLKEIANSYSKQESRIFYKQVNSGKKEFKPRTSACRNKDGQLLNDRTEVIKRWAEHFQELLNKPSVATHIDEVEAPLNHQWLEVSQPSLEDTRAASQKLKNNKAPGNDNIQSELLKYAGSQFEEEFHKLVLQIWNSEVMPEEWNTAVICPLHKKGDVLDCQNYRGISLLNTAYKIFANVLFGKLKPFVEPRLGEYQCGFRPGRSTIDQIFSLRQILEKTLEFNADTYHLFIDFKAAYDNISRDFLYQAMHEIGVPPKLISLTRMTLVASQSIVKIQTDLSDPFRTHDGLRQGDALSCLLFNVALDKCIRDSAIETTGNIYYKSAQVLGYADDIDVIGRSALAVESAYLALEASSLEAGLQVNADKTKFLRVSRDLREDTAHKNIGQHTFGSVNEFVYLGSLITNNNNITAEIVKRILSANKCYFGLLKYFCSKILSRNIKIILYKTLLRPILIYGSETWVLSKKDENRLLVFERKILRRIFGAVRENEIWRTRYNHELYDVYKDPNIITTIKIGRLRWAGHVVRMESTRMPRQLLYGKPEGRRSRGRPKLRWLDGVERDLKNIGVKNWKEKALNRAVWRNILDQAKAHPGL

Summary

EMBL
FJ265555    ADI61823.1    GBBI01004263    JAC14449.1    GBBI01004261    JAC14451.1    + More
PYGN01000613    PSN43351.1    PYGN01000119    PSN53667.1    GBBI01004262    JAC14450.1    GGFL01003846    MBW68024.1    GGFL01003845    MBW68023.1    GGFK01005184    MBW38505.1    GBRD01011073    JAG54751.1    GGFK01001798    MBW35119.1    GGFK01003613    MBW36934.1    GGFK01001949    MBW35270.1    GECL01001585    JAP04539.1    GBBI01004198    JAC14514.1    GALA01001775    JAA93077.1    GAPW01000107    JAC13491.1    CH902657    KPU75308.1    KU311054    ALX81665.1    LBMM01005351    KMQ91586.1    AJVK01001578    CH902621    KPU81727.1    CH902626    KPU79149.1    GBGD01000331    JAC88558.1    CH902628    KPU75346.1    GDHC01021627    JAP97001.1    CH902666    KPU74610.1    CH902618    KPU79125.1    GECL01002632    JAP03492.1    CH902630    KPU77522.1    CH902622    CH902619    KPU75266.1    KPU77326.1    CH902633    KPU74667.1    CH902623    KPU72899.1    CH902627    KPU74872.1    GAPW01000120    JAC13478.1    UZAG01001147    VDO10529.1    GBBI01004199    JAC14513.1    CH963259    KRF97428.1    GAPW01000199    JAC13399.1    PYGN01000372    PSN47498.1    CH902714    KPU81861.1    PYGN01000254    PSN50032.1    PYGN01000203    PSN51319.1    AJWK01020943    PYGN01000020    PSN57453.1    PYGN01000324    PSN48495.1    PYGN01003402    PSN29545.1    HE799691    CCH14900.1    GAPW01000151    JAC13447.1    PYGN01001004    PSN38555.1    PYGN01000070    PSN55417.1    PYGN01000219    PSN50892.1    ABLF02019047    ABLF02019049    GGMR01006433    MBY19052.1    ABLF02039015    GGFK01002192    MBW35513.1    GGFK01002196    MBW35517.1    GGMR01010991    MBY23610.1    GGMR01020071    MBY32690.1    ABLF02018097    ABLF02043469    ABLF02056908    IAAA01017079    LAA06070.1    PYGN01000287    PSN49259.1    PYGN01000629    PSN43121.1    ABLF02066124    PYGN01000502    PSN45243.1    PYGN01000107    PSN54137.1    GDAI01000742    JAI16861.1    ABLF02035454    ABLF02035459    ABLF02035461    ABLF02042121    KPU79150.1    PYGN01000047    PSN56294.1    KPU76535.1    ABLF02042851    CH902653    KPU74858.1    CH904714    KPU81814.1    PYGN01000212    PSN51056.1    QOIP01000009    RLU18885.1    PYGN01001465    PSN34679.1    GBHO01037471    GBRD01009355    GBRD01009354    GDHC01014856    GDHC01007898    JAG06133.1    JAG56469.1    JAQ03773.1    JAQ10731.1    ABLF02027703    ABLF02061609    GEHC01000890    JAV46755.1    PYGN01001382    PSN35227.1    GFTR01007842    JAW08584.1    PYGN01001388    PSN35187.1    GBGD01000583    JAC88306.1    GBGD01000559    JAC88330.1    GGMR01008290    MBY20909.1    ABLF02017638    ABLF02041349    GEZM01048836    JAV76363.1    ABLF02018925    PYGN01000451    PSN46127.1    ABLF02020712    ABLF02020717    ABLF02054820    ABLF02012660   
Pfam
PF00078   RVT_1        + More
PF03372   Exo_endo_phos
PF14529   Exo_endo_phos_2
PF13359   DDE_Tnp_4
PF05699   Dimer_Tnp_hAT
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000637   HMGI/Y_DNA-bd_CS       
IPR027806   HARBI1_dom       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D
PDB
6AR3     E-value=0.000201196,     Score=110

Ontologies

Topology

Length:
885
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00504
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00010
outside
1  -  885
 
 

Population Genetic Test Statistics

Pi
2.117153
Theta
16.455132
Tajima's D
-1.019825
CLR
5.671903
CSRT
0.130893455327234
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号