Gene

KWMTBOMO08110  Validated by peptides from experiments

Pre Gene Modal

BGIBMGA001062

Annotation

hemolin-interacting_protein_[Bombyx_mori]

Location

Bomo_Chr13(+):16042917-16044580      View in EpiBrowser

Full name

Protein yippee-like       + More
Protein yippee-like 5      

Location in the cell

Cytoplasmic   Reliability : 1.121

CDS

ATGGGTAAAATATTTCTTGATCATATTGGAGGAACGCGACTATTTTCATGCGCATCATGCGATGTCAATCTTACGAATCGTTCCGAATTAATAAGTACGCGATTTACTGGAGCTACAGGTCGTGCATTCTTATTCCACAAGGTTGTGAATCTAATCTATTCGGAAGTTCAGGATCGTGTGATGCTAACAGGACGTCACATGGTGCGTGATGTTTCTTGTAAGAACTGCGGTACGAAGCTGGGTTGGGTATATGAATTTGCAACTGAAGAGAATCAAAGATACAAGGAAGGGAGAGTAATATTGGAACGAGCTTTGGTCACGGAGAGTGATGGTATTGAAGAAATTCAAGTTAATGTTGATGATTAA

Protein

MGKIFLDHIGGTRLFSCASCDVNLTNRSELISTRFTGATGRAFLFHKVVNLIYSEVQDRVMLTGRHMVRDVSCKNCGTKLGWVYEFATEENQRYKEGRVILERALVTESDGIEEIQVNVDD

Description

Component of the CTLH E3 ubiquitin-protein ligase complex that selectively accepts ubiquitin from UBE2H and mediates ubiquitination and subsequent proteasomal degradation of the transcription factor HBP1 (By similarity). Required for normal cell proliferation (By similarity).

Subunit

Identified in the CTLH complex that contains GID4, RANBP9 and/or RANBP10, MKLN1, MAEA, RMND5A (or alternatively its paralog RMND5B), GID8, ARMC8, WDR26 and YPEL5. Within this complex, MAEA, RMND5A (or alternatively its paralog RMND5B), GID8, WDR26, and RANBP9 and/or RANBP10 form the catalytic core, while GID4, MKLN1, ARMC8 and YPEL5 have ancillary roles. Interacts with RANBP9 and RANBP10.

Similarity

Belongs to the yippee family.

Keywords

Complete proteome   Cytoplasm   Cytoskeleton   Metal-binding   Nucleus   Phosphoprotein   Zinc  

Feature

chain  Protein yippee-like 5

Uniprot

Q6SA01   A0A2H1WWH2   A0A2A4K2Y3   A0A1E1WPX6   A0A3S2P4P8   A0A194RFZ2   + More
I4DK07   A0A212ETS8   A0A224Z3W4   L7M5Z7   A0A131ZA47   A0A131X9G1   C3Z3Q0   S4PWV5   A0A2R5LLA5   A0A1B6EA67   A0A1D2N3S3   A0A1Z5L8G6   A0A1Y1JUJ2   A0A2J7Q4V5   A0A067RIH0   A0A2P8YIH4   G3MT67   A0A1E1WZG2   D1ZZ86   A0A1S3J7E3   B7QER8   A7RW79   E0W3L0   A0A131Y876   A0A1B6EKJ4   A0A1B6JNF4   A0A443RGG9   K1QGC0   E2C1I1   T1IRR8   A0A0L8GVU7   A0A1E1XU50   A0A023FG82   A0A2K6NVL1   A0A443SQU8   A0A210R2P2   U4TZI1   A0A0K8RQ91   L5LPC7   A0A195C5R8   E9IA94   A0A0J7LAA8   A0A1S3DGZ4   A0A1B6K9F0   A0A2L2YE84   A0A3Q0JG63   A0A195ELV1   F4WCK0   A0A195B5R8   A0A195ESZ2   A0A158NIH7   A0A151XBN3   E2A6J3   A0A226ET13   Q4R4Q6   A0A1W4XBS3   A0A0L7QPD8   G1PEP3   A0A0A9W0I6   A0A2J8K0L3   J3JWR4   G1T5J7   A0A2K6DLT3   A0A2K6JZM0   L5KRN1   D2HY36   J9P1Y9   G1RZT5   A0A341ACJ8   A0A2K5ZV75   A0A0D9RFC7   A0A452G1R1   G3T484   U6CQC6   A0A340YFW5   A0A2R9A6P4   A0A2K5CBV0   A0A096MNR6   A0A2Y9F583   F6VI71   A0A2U3Z7S3   H0XU49   F7D9K6   A0A3P4M7F2   A0A1U7TJY5   A0A2Y9N6H3   A0A2K5I7M2   A0A2K6S718   A0A2K6F1F8   A0A384AVK8   S7QFQ1   A0A452QP87   A0A2Y9R9D9   A0A2J8VNF7  

Pubmed

19121390    26354079    22651552    22118469    28797301    25576852    + More
26830274    28049606    18563158    23622113    27289101    28528879    28004739    24845553    29403074    22216098    28503490    18362917    19820115    17615350    20566863    22992520    20798317    29209593    25362486    28812685    23537049    21282665    26561354    21719571    21347285    21993624    25401762    26823975    22516182    23258410    20010809    16341006    22722832    17495919    18464734   

EMBL

BABH01000166    AY461708    AAR97570.1    ODYU01011528    SOQ57316.1    NWSH01000210    + More
PCG78375.1    PCG78376.1    GDQN01009472    GDQN01003688    GDQN01002793    GDQN01002004    JAT81582.1    JAT87366.1    JAT88261.1    JAT89050.1    RSAL01000023    RVE52270.1    KQ460297    KPJ16225.1    AK401625    KQ459439    BAM18247.1    KPJ01042.1    AGBW02012542    OWR44854.1    GFPF01013400    MAA24546.1    GACK01006481    JAA58553.1    GEDV01000872    JAP87685.1    GEFH01005008    JAP63573.1    GG666577    EEN52814.1    GAIX01006128    JAA86432.1    GGLE01006180    MBY10306.1    GEDC01002466    JAS34832.1    LJIJ01000260    ODM99714.1    GFJQ02003257    JAW03713.1    GEZM01100257    GEZM01100254    JAV52952.1    NEVH01018373    PNF23619.1    KK852484    KDR22828.1    PYGN01000570    PSN44049.1    JO845068    AEO36685.1    GFAC01006783    JAT92405.1    KQ971338    EFA01888.1    ABJB010793074    DS922060    EEC17340.1    DS469546    EDO44220.1    DS235882    EEB20216.1    GEFM01000367    JAP75429.1    GECZ01031320    JAS38449.1    GECU01007094    JAT00613.1    NCKU01000742    RWS14372.1    JH817885    EKC20576.1    GL451937    EFN78157.1    JH431378    KQ420176    KOF81027.1    GFAA01000610    JAU02825.1    GBBK01004337    GBBK01004336    JAC20145.1    NCKV01000717    RWS29916.1    NEDP02000749    OWF55185.1    KB631802    ERL86242.1    GADI01000598    JAA73210.1    KB110330    ELK27348.1    KQ978292    KYM95526.1    GL761996    EFZ22509.1    LBMM01000123    KMR04842.1    GEBQ01031905    JAT08072.1    IAAA01022132    IAAA01022133    LAA06448.1    KQ978739    KYN28902.1    GL888070    EGI68180.1    KQ976582    KYM79863.1    KQ981979    KYN31276.1    ADTU01001809    KQ982327    KYQ57698.1    GL437132    EFN70950.1    LNIX01000002    OXA59951.1    AB169838    KQ414843    KOC60336.1    AAPE02028472    AAPE02028473    GBHO01041662    GBHO01041661    GBRD01012667    GDHC01014353    JAG01942.1    JAG01943.1    JAG53157.1    JAQ04276.1    NBAG03000402    PNI28531.1    APGK01057804    BT127682    KB741282    AEE62644.1    ENN70790.1    AAGW02005775    KB030580    ELK14099.1    GL193669    EFB21105.1    AAEX03010815    ADFV01011471    ADFV01011472    AQIB01034385    LWLT01000009    HAAF01000216    CCP72042.1    AJFE02095320    AJFE02095321    AHZZ02005120    AAQR03049618    AAQR03049619    AAQR03049620    AAQR03049621    CYRY02008077    VCW76914.1    KE164790    EPQ20142.1    NDHI03003415    PNJ59042.1   

Proteomes

UP000005204    UP000218220    UP000283053    UP000053240    UP000053268    UP000007151    + More
UP000001554    UP000094527    UP000235965    UP000027135    UP000245037    UP000007266    UP000085678    UP000001555    UP000001593    UP000009046    UP000285301    UP000005408    UP000008237    UP000053454    UP000233200    UP000288716    UP000242188    UP000030742    UP000078542    UP000036403    UP000079169    UP000078492    UP000007755    UP000078540    UP000078541    UP000005205    UP000075809    UP000000311    UP000198287    UP000233100    UP000192223    UP000053825    UP000001074    UP000019118    UP000001811    UP000233120    UP000233180    UP000010552    UP000002254    UP000001073    UP000252040    UP000233140    UP000029965    UP000291000    UP000007646    UP000265300    UP000240080    UP000233020    UP000028761    UP000248484    UP000002280    UP000245341    UP000005225    UP000002279    UP000189704    UP000248483    UP000233080    UP000233220    UP000233160    UP000261681    UP000291022    UP000248480   

PRIDE

Q6SA01   

Pfam

PF03226   Yippee-Mis18

Interpro

IPR034751   Yippee        + More
IPR039058   Yippee_fam       
IPR004910   Yippee/Mis18/Cereblon       

ProteinModelPortal

Q6SA01   A0A2H1WWH2   A0A2A4K2Y3   A0A1E1WPX6   A0A3S2P4P8   A0A194RFZ2   + More
I4DK07   A0A212ETS8   A0A224Z3W4   L7M5Z7   A0A131ZA47   A0A131X9G1   C3Z3Q0   S4PWV5   A0A2R5LLA5   A0A1B6EA67   A0A1D2N3S3   A0A1Z5L8G6   A0A1Y1JUJ2   A0A2J7Q4V5   A0A067RIH0   A0A2P8YIH4   G3MT67   A0A1E1WZG2   D1ZZ86   A0A1S3J7E3   B7QER8   A7RW79   E0W3L0   A0A131Y876   A0A1B6EKJ4   A0A1B6JNF4   A0A443RGG9   K1QGC0   E2C1I1   T1IRR8   A0A0L8GVU7   A0A1E1XU50   A0A023FG82   A0A2K6NVL1   A0A443SQU8   A0A210R2P2   U4TZI1   A0A0K8RQ91   L5LPC7   A0A195C5R8   E9IA94   A0A0J7LAA8   A0A1S3DGZ4   A0A1B6K9F0   A0A2L2YE84   A0A3Q0JG63   A0A195ELV1   F4WCK0   A0A195B5R8   A0A195ESZ2   A0A158NIH7   A0A151XBN3   E2A6J3   A0A226ET13   Q4R4Q6   A0A1W4XBS3   A0A0L7QPD8   G1PEP3   A0A0A9W0I6   A0A2J8K0L3   J3JWR4   G1T5J7   A0A2K6DLT3   A0A2K6JZM0   L5KRN1   D2HY36   J9P1Y9   G1RZT5   A0A341ACJ8   A0A2K5ZV75   A0A0D9RFC7   A0A452G1R1   G3T484   U6CQC6   A0A340YFW5   A0A2R9A6P4   A0A2K5CBV0   A0A096MNR6   A0A2Y9F583   F6VI71   A0A2U3Z7S3   H0XU49   F7D9K6   A0A3P4M7F2   A0A1U7TJY5   A0A2Y9N6H3   A0A2K5I7M2   A0A2K6S718   A0A2K6F1F8   A0A384AVK8   S7QFQ1   A0A452QP87   A0A2Y9R9D9   A0A2J8VNF7  

KEGG

692641    K23339 protein yippee-like 5 | (RefSeq) hemolin-interacting protein

GO

GO:0046872   GO:0000151   GO:0008283   GO:0097431   GO:0005634   GO:0005815   GO:0005737   GO:0030496  

PANTHER

PTHR13848  

Subcellular location

Nucleus   Deteted in nucleus and at the centrosome during interphase. During mitosis, detected on the mitotic spindle, at spindle poles and at the midbody.   With evidence from 3 publications.
Cytoplasm   Deteted in nucleus and at the centrosome during interphase. During mitosis, detected on the mitotic spindle, at spindle poles and at the midbody.   With evidence from 3 publications.
Cytoskeleton   Deteted in nucleus and at the centrosome during interphase. During mitosis, detected on the mitotic spindle, at spindle poles and at the midbody.   With evidence from 3 publications.
Microtubule organizing center   Deteted in nucleus and at the centrosome during interphase. During mitosis, detected on the mitotic spindle, at spindle poles and at the midbody.   With evidence from 3 publications.
Centrosome   Deteted in nucleus and at the centrosome during interphase. During mitosis, detected on the mitotic spindle, at spindle poles and at the midbody.   With evidence from 3 publications.
Spindle pole   Deteted in nucleus and at the centrosome during interphase. During mitosis, detected on the mitotic spindle, at spindle poles and at the midbody.   With evidence from 3 publications.
Midbody   Deteted in nucleus and at the centrosome during interphase. During mitosis, detected on the mitotic spindle, at spindle poles and at the midbody.   With evidence from 3 publications.

Length:

121

Number of predicted TMHs:

0

Exp number of AAs in TMHs:

0.023

Exp number, first 60 AAs:

0.02297

Total prob of N-in:

0.06288

outside

1  -  121

 

 

Pi

21.638885

Theta

21.467342

Tajima's D

-0.057104

CLR

0.378511

CSRT

0.355782210889456

Interpretation

Uncertain