Gene

KWMTBOMO08102  Validated by peptides from experiments

Pre Gene Modal

BGIBMGA001105

Annotation

hypothetical_protein_KGM_21242_[Danaus_plexippus]

Location

Bomo_Chr13(-):15961981-15963106      View in EpiBrowser

Full name

Nitric oxide synthase-interacting protein homolog       + More
Nitric oxide synthase-interacting protein      
CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase      
E3 ubiquitin-protein ligase CSU1      

Alternative Name

E3 ubiquitin-protein ligase NOSIP
RING-type E3 ubiquitin transferase NOSIP
eNOS-interacting protein
Protein COP1 SUPPRESSOR 1
RING-type E3 ubiquitin transferase CSU1

Location in the cell

Nuclear   Reliability : 2.384

CDS

ATGACTCGACACGCTCGAAATTGTACAGCAGGTGCTGTGTATACATATCATGAAAAGAAAAAGGACGCTGCTGCTTCTGGCTACGGTACTCAAAGTGAACGTGTCGGAAAAGACTCCATAAAAAACTTTGATTGCTGCAGCCTAACATTACAGCCTTGTAGAAACCCTGTGGTCACAAAAGAAGGCTACTTATTCGATAAGGAAGCTATTTTAGAGTACATCATCAGTAAGAAGAACGCATATAACCGCTTATTAAAGAAATATGAGAAACAATTAAAAAAAGATGAAGTTGAAAGAGCCGAGCTTGCGGTGGCTGAAAAAGAAGCGAAACTCATTAAATTCATGAACAGGGAAAAAAATATTTCATCTACTACACCAAGTACTTCAGCTATAGAGGAAAAAACGATAAATTCAGTATCAAATATAGCGAATGGTAAAGAAAAACAGTTACCTAGTTTTTGGGTACCATCCCAACTTCCCGATGCAAAGATTTCGAAAATAGAAAAACCTGATCCAACCGTTTACTGTCCGATCAGCGGCAAACCATTGAAAATGAAGGATTTAATAGAAGTTAAGTGGACATTGGTGAATGATCCAGATGATAAGAAGTCTTTAATAGCCAAAGAAAACCGGTACATGTGTCCAGTGACACATGATATATTAAGTAATGCTGTGCCCTGCGCTGTTATCAGAACTTCAGGACATGTTGTGACAATGGAATGTGTTGAGAAAATCATAAAAAAAGATTGGTTGCATCCATTAACTGGTGAGAAACTTAAAGAAAAAGATATAATTCTACTGCAAAGAGGGGGCACTGGATATGCACTCACCAATCAAAACCTAGAAGGGAAAAATGAAAGGCCTGTTTTACAAGCGTAA

Protein

MTRHARNCTAGAVYTYHEKKKDAAASGYGTQSERVGKDSIKNFDCCSLTLQPCRNPVVTKEGYLFDKEAILEYIISKKNAYNRLLKKYEKQLKKDEVERAELAVAEKEAKLIKFMNREKNISSTTPSTSAIEEKTINSVSNIANGKEKQLPSFWVPSQLPDAKISKIEKPDPTVYCPISGKPLKMKDLIEVKWTLVNDPDDKKSLIAKENRYMCPVTHDILSNAVPCAVIRTSGHVVTMECVEKIIKKDWLHPLTGEKLKEKDIILLQRGGTGYALTNQNLEGKNERPVLQA

Description

Negatively regulates nitric oxide production by inducing nitric oxide synthase translocation to actin cytoskeleton and inhibiting its enzymatic activity.
E3 ubiquitin-protein ligase that is essential for proper development of the forebrain, the eye, and the face (By similarity). Negatively regulates nitric oxide production by inducing nitric oxide synthase translocation to actin cytoskeleton and inhibiting its enzymatic activity (By similarity).
E3 ubiquitin-protein ligase that is essential for proper development of the forebrain, the eye and the face. Catalyzes monoubiquitination of serine/threonine-protein phosphatase 2A (PP2A) catalytic subunit PPP2CA/PPP2CB (PubMed:25546391). Negatively regulates nitric oxide production by inducing NOS1 and NOS3 translocation to actin cytoskeleton and inhibiting their enzymatic activity (By similarity).
E3 ubiquitin-protein ligase that is essential for proper development of the forebrain, the eye, and the face. Catalyzes monoubiquitination of serine/threonine-protein phosphatase 2A (PP2A) catalytic subunit PPP2CA/PPP2CB (By similarity). Negatively regulates nitric oxide production by inducing NOS1 and NOS3 translocation to actin cytoskeleton and inhibiting their enzymatic activity (By similarity).
Negatively regulates nitric oxide production by inducing NOS1 and NOS3 translocation to actin cytoskeleton and inhibiting their enzymatic activity.
E3 ubiquitin-protein ligase that is essential for proper development of the forebrain, the eye, and the face. Catalyzes monoubiquitination of serine/threonine-protein phosphatase 2A (PP2A) catalytic subunit PPP2CA/PPP2CB (By similarity). Negatively regulates nitric oxide production by inducing NOS1 and NOS3 translocation to actin cytoskeleton and inhibiting their enzymatic activity (PubMed:11149895, PubMed:15548660, PubMed:16135813).
Functions in the biosynthesis of the anionic phospholipids phosphatidylglycerol and cardiolipin.
RING-finger E3 ubiquitin-protein ligase that plays an major role in maintaining COP1 homeostasis in darkness. Negatively regulates COP1 protein accumulation by targeting COP1 for ubiquitination and subsequent proteasomal degradation in dark-grown seedlings. Negatively regulates the accumulation of SPA1 protein in the dark.

Catalytic Activity

S-ubiquitinyl-[E2 ubiquitin-conjugating enzyme]-L-cysteine + [acceptor protein]-L-lysine = [E2 ubiquitin-conjugating enzyme]-L-cysteine + N(6)-ubiquitinyl-[acceptor protein]-L-lysine.
a CDP-1,2-diacyl-sn-glycerol + sn-glycerol 3-phosphate = 1,2-diacyl-sn-glycero-3-phospho-(1'-sn-glycero-3'-phosphate) + CMP + H(+)

Subunit

Interacts with NOS1 and NOS3 (By similarity). Interacts with PP2A holoenzyme, containing PPP2CA, PPP2CB, PPP2R1A and PPP2R2A subunits (PubMed:25546391).
Interacts with NOS1 and NOS3 (By similarity). Interacts with PP2A holoenzyme, containing PPP2CA, PPP2CB, PPP2R1A and PPP2R2A subunits (By similarity).
Interacts with NOS1 and NOS3 (PubMed:11149895, PubMed:15548660). Interacts with PP2A holoenzyme, containing PPP2CA, PPP2CB, PPP2R1A and PPP2R2A subunits (By similarity).

Similarity

Belongs to the NOSIP family.
Belongs to the CDP-alcohol phosphatidyltransferase class-II family.

Keywords

Complete proteome   Cytoplasm   Nucleus   Reference proteome   Developmental protein   Transferase   Ubl conjugation pathway   Alternative splicing   Phosphoprotein   Polymorphism   Coiled coil   Metal-binding   Repeat   Zinc   Zinc-finger  

Feature

chain  Nitric oxide synthase-interacting protein homolog
splice variant  In isoform 2.
sequence variant  In dbSNP:rs17850728.

Uniprot

A0A212ETN0   A0A0K8TR47   Q7Q6V1   W5JQQ8   A0A2M4BVG0   A0A0A9WHI3   + More
E0W1Z8   A0A2M4BWG0   B0X5V0   A0A1B6CB42   A0A151WSX2   A0A023EQ08   Q17JB3   A0A336MB93   A0A026W1Z5   A0A1B6KCL9   Q9VWV8   J3JY00   A0A069DR42   A0A1A9WBN3   A0A1B0GGZ2   B7PFR6   E9G2C9   A0A182SM80   Q6P829   A0A1S3H666   Q6NUH3   T1ENQ8   V3Z1G9   Q9D6T0   Q5U3S7   R7UYT0   T1KYE4   Q3SWY5   A0A190PWK3   A0A075B6F9   Q9Y314   Q4R7H4   A8K670   A0A0P5QCV6   A0A3M6TFA0   Q16YX4   A0A0N4X2B0   A0A0R3PWV5   A0A1I7VFA5   A0A2G9UUQ6   A0A0N5CLX2   A0A0M3J0G0   K1R056   A0A132AME2   A0A158R129   Q21755   A0A1I7SM35   A0A0N4V7K2   E3M7E0   A0A183UY22   A0A0N4UBI2   A0A0V1HC77   A0A0N4TWZ0   A0A182ED14   A0A085MJ90   A0A183AIQ0   A0A0V0RHY8   M0R3B2   A0A183N7C6   A0A183JZH4   A0A090LQL2   A0A0X3NTE7   A0A183TMN6   A0A183P8M2   F2UHH0   A0A2K6VRM2   U6J9S4   A0A0R3X1A7   A0A0R3SGY8   A0A158QIK6   A0A0R3VUJ0   A0A158QS55   A0A267EY14   A0A183WWP5   A0A183DUG3   M0R1K2   Q9SY88   A0A0L0HS29   F0VRH8   A0A1Y2EUK9   A0A1Y1XYT0   A0A0G4IPB6   A0A162RCT6   A0A1X0S075   A0A367K8L7   A0A1Y1VQI6   A0A0C9M5W5   A0A1X0R4B0  

EC Number

2.7.8.5
2.3.2.27

Pubmed

22118469    26369729    12364791    14747013    17210077    20920257    + More
23761445    25401762    26823975    20566863    24945155    26483478    17510324    24508170    30249741    10731132    12537572    22516182    23537049    26334808    21292972    23254933    16141072    15489334    21183079    25546391    15057824    16964243    17525332    18669648    19413330    21269460    23186163    24275569    11149895    10810093    15548660    16135813    20068231    30382153    25217238    22992520    26555130    9851916    21909270    26114425    26394399    22919073    24929829    24013640    23485966    15644464    11130712    27862469    11910074    24838976    25875305    27956601    29674435   

EMBL

AGBW02012542    OWR44846.1    GDAI01001007    JAI16596.1    AAAB01008960    EAA11755.3    + More
ADMH02000773    ETN65089.1    GGFJ01007916    MBW57057.1    GBHO01036375    GBRD01010196    GDHC01001268    JAG07229.1    JAG55628.1    JAQ17361.1    DS235873    EEB19592.1    GGFJ01007917    MBW57058.1    DS232396    EDS41081.1    GEDC01026597    GEDC01011349    JAS10701.1    JAS25949.1    KQ982766    KYQ50980.1    JXUM01024455    GAPW01002974    KQ560691    JAC10624.1    KXJ81256.1    CH477233    EAT46791.1    UFQS01000784    UFQT01000784    SSX06866.1    SSX27210.1    KK107485    QOIP01000006    EZA50087.1    RLU21941.1    GEBQ01030785    GEBQ01008544    GEBQ01006888    JAT09192.1    JAT31433.1    JAT33089.1    AE014298    APGK01049566    BT128122    KB741156    AEE63083.1    ENN73545.1    GBGD01002351    JAC86538.1    AJWK01000975    AJWK01000976    ABJB010300094    ABJB010778202    ABJB010804049    DS704057    EEC05438.1    GL732530    EFX86228.1    BC061402    BC068614    AMQM01000211    KB095811    ESO12630.1    KB203534    ESO84363.1    AK007962    AK010006    BC089029    BC085409    AMQN01006514    KB298546    ELU09087.1    CAEY01000711    BC104600    KU214505    ALV82313.1    AC010619    KF456600    AF132959    BC009299    BC010077    BC011249    AB168844    AK291535    BAF84224.1    GDIQ01137296    GDIP01012981    JAL14430.1    JAM90734.1    RCHS01003767    RMX39894.1    CH477507    EAT39813.1    UZAF01020609    VDO71379.1    UYYA01004524    VDM62272.1    JH712100    EFO19847.2    KZ345355    PIO73967.1    UYYF01000121    VDM96392.1    UYRR01000768    VDK18199.1    JH818089    EKC34480.1    JXLN01018806    KPM12089.1    UYSL01020913    VDL76591.1    FO081426    UXUI01008299    VDD91128.1    DS268427    LFJK02000008    EFO93649.1    POM43146.1    UYWY01021700    VDM44713.1    UYYG01001168    VDN58472.1    JYDP01000093    KRZ08025.1    UZAD01013387    VDN94579.1    UYRW01001730    VDK80263.1    KL363189    KL367476    KFD57286.1    KFD72673.1    UZAN01043869    VDP79458.1    JYDL01000171    KRX14115.1    UZAI01020228    VDP50341.1    UZAK01032615    VDP29408.1    LN609529    CEF70471.1    GEEE01020835    GEEE01015020    GEEE01014658    JAP42390.1    JAP48205.1    UYSU01043006    VDM04121.1    UZAL01030807    VDP55640.1    GL832974    EGD76569.1    CMVM020000060    LK028578    APAU02000013    CDS18463.1    EUB62319.1    UYWX01020334    VDM31246.1    UYSG01001506    VDL45189.1    UZAE01012653    VDO06108.1    UYRS01000181    VDK22273.1    UXSR01000026    VDD74327.1    NIVC01003183    NIVC01001558    PAA52781.1    PAA66423.1    UZAO01089842    VDQ12428.1    UYRT01079253    VDN20306.1    DQ059102    AC005850    CP002684    AK117181    BT026113    AY085557    AAD25548.1    KQ257451    KND03892.1    FR823393    LN714487    CBZ56326.1    CEL71086.1    MCOG01000026    ORY75239.1    MCFE01000354    ORX90901.1    CDSF01000078    OVEO01000016    CEO97009.1    SPR00989.1    AMYB01000003    OAD04169.1    KV921349    ORE17692.1    PJQL01000217    RCH98181.1    MCFG01000618    ORX63540.1    DF836303    GAN01979.1    KV921916    ORE06811.1   

Proteomes

UP000007151    UP000007062    UP000000673    UP000009046    UP000002320    UP000075809    + More
UP000069940    UP000249989    UP000008820    UP000053097    UP000279307    UP000000803    UP000019118    UP000091820    UP000092461    UP000001555    UP000000305    UP000075901    UP000008143    UP000085678    UP000015101    UP000030746    UP000000589    UP000000437    UP000014760    UP000015104    UP000009136    UP000005640    UP000233100    UP000275408    UP000038042    UP000268014    UP000050601    UP000267027    UP000095285    UP000046394    UP000276776    UP000036680    UP000005408    UP000038043    UP000271162    UP000001940    UP000095284    UP000038041    UP000274131    UP000008281    UP000237256    UP000050794    UP000267007    UP000038040    UP000274756    UP000055024    UP000038020    UP000278627    UP000077448    UP000271087    UP000050740    UP000054630    UP000050790    UP000277204    UP000050789    UP000035682    UP000050788    UP000275846    UP000050791    UP000007799    UP000024404    UP000019149    UP000046396    UP000274429    UP000046397    UP000274504    UP000046398    UP000278807    UP000046400    UP000282613    UP000046399    UP000267029    UP000215902    UP000050795    UP000050760    UP000006548    UP000053201    UP000193920    UP000193498    UP000039324    UP000290189    UP000077051    UP000242381    UP000252139    UP000193944    UP000053815    UP000242414   

PRIDE

Q9VWV8    Q6P829    Q6NUH3    Q9D6T0    Q3SWY5    A0A075B6F9    + More
Q9Y314    Q4R7H4    A8K670    M0R3B2    M0R1K2    Q9SY88   

Pfam

PF04641   Rtf2        + More
PF15906   zf-NOSIP
PF13426   PAS_9
PF00010   HLH
PF00400   WD40
PF03099   BPL_LplA_LipB
PF13091   PLDc_2
PF00614   PLDc
PF14634   zf-RING_5

Interpro

IPR031790   Znf-NOSIP        + More
IPR016818   NOSIP       
IPR027799   Rtf2_RING-finger       
IPR013083   Znf_RING/FYVE/PHD       
IPR036638   HLH_DNA-bd_sf       
IPR035965   PAS-like_dom_sf       
IPR000014   PAS       
IPR001067   Nuc_translocat       
IPR011598   bHLH_dom       
IPR003613   Ubox_domain       
IPR020472   G-protein_beta_WD-40_rep       
IPR019775   WD40_repeat_CS       
IPR036322   WD40_repeat_dom_sf       
IPR015943   WD40/YVTN_repeat-like_dom_sf       
IPR017986   WD40_repeat_dom       
IPR001680   WD40_repeat       
IPR004143   BPL_LPL_catalytic       
IPR016270   PGS1       
IPR025202   PLD-like_dom       
IPR001736   PLipase_D/transphosphatidylase       
IPR017907   Znf_RING_CS       
IPR001841   Znf_RING       
IPR011011   Znf_FYVE_PHD       

SUPFAM

SSF47459   SSF47459        + More
SSF55785   SSF55785       
SSF50978   SSF50978       
SSF57903   SSF57903       

Gene 3D

3.30.40.10     4.10.280.10     2.130.10.10    

CDD

cd00083  HLH
cd00130  PAS

ProteinModelPortal

A0A212ETN0   A0A0K8TR47   Q7Q6V1   W5JQQ8   A0A2M4BVG0   A0A0A9WHI3   + More
E0W1Z8   A0A2M4BWG0   B0X5V0   A0A1B6CB42   A0A151WSX2   A0A023EQ08   Q17JB3   A0A336MB93   A0A026W1Z5   A0A1B6KCL9   Q9VWV8   J3JY00   A0A069DR42   A0A1A9WBN3   A0A1B0GGZ2   B7PFR6   E9G2C9   A0A182SM80   Q6P829   A0A1S3H666   Q6NUH3   T1ENQ8   V3Z1G9   Q9D6T0   Q5U3S7   R7UYT0   T1KYE4   Q3SWY5   A0A190PWK3   A0A075B6F9   Q9Y314   Q4R7H4   A8K670   A0A0P5QCV6   A0A3M6TFA0   Q16YX4   A0A0N4X2B0   A0A0R3PWV5   A0A1I7VFA5   A0A2G9UUQ6   A0A0N5CLX2   A0A0M3J0G0   K1R056   A0A132AME2   A0A158R129   Q21755   A0A1I7SM35   A0A0N4V7K2   E3M7E0   A0A183UY22   A0A0N4UBI2   A0A0V1HC77   A0A0N4TWZ0   A0A182ED14   A0A085MJ90   A0A183AIQ0   A0A0V0RHY8   M0R3B2   A0A183N7C6   A0A183JZH4   A0A090LQL2   A0A0X3NTE7   A0A183TMN6   A0A183P8M2   F2UHH0   A0A2K6VRM2   U6J9S4   A0A0R3X1A7   A0A0R3SGY8   A0A158QIK6   A0A0R3VUJ0   A0A158QS55   A0A267EY14   A0A183WWP5   A0A183DUG3   M0R1K2   Q9SY88   A0A0L0HS29   F0VRH8   A0A1Y2EUK9   A0A1Y1XYT0   A0A0G4IPB6   A0A162RCT6   A0A1X0S075   A0A367K8L7   A0A1Y1VQI6   A0A0C9M5W5   A0A1X0R4B0  

KEGG

101737494    K13125 nitric oxide synthase-interacting protein | (RefSeq) nitric oxide synthase-interacting protei

GO

GO:0061630   GO:0005634   GO:0043086   GO:0003723   GO:0071013   GO:0000398   GO:0005737   GO:0051001   GO:0046983   GO:0003700   GO:0005667   GO:0007275   GO:0000139   GO:0005829   GO:0050999   GO:0016021   GO:0004842   GO:0006464   GO:0008444   GO:0005739   GO:0032049   GO:0005524   GO:0016607   GO:0046872   GO:0009640   GO:0031648   GO:0005622   GO:0005840   GO:0006412   GO:0015934   GO:0015914   GO:0016876   GO:0043039  

PANTHER

PTHR13063   PTHR12586  

Subcellular location

Nucleus  
Cytoplasm  
Mitochondrion  
Nucleus speckle   Is recruited to nuclear speckles by COP1 in the dark.   With evidence from 3 publications.

Length:

292

Number of predicted TMHs:

0

Exp number of AAs in TMHs:

0.00823

Exp number, first 60 AAs:

0

Total prob of N-in:

0.25705

outside

1  -  292

 

 

Pi

14.453129

Theta

18.654913

Tajima's D

-0.927279

CLR

1.000563

CSRT

0.144442777861107

Interpretation

Uncertain