SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08091
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.483 Nuclear   Reliability : 2.143
 

Sequence

CDS
ATGCGTGCCCTACAACGCGACGTAAAATCTCGCATCGCCGAAGTCCGAGATGCCAGGTGGTCTGATTTCTTAGAAAGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAACTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTACTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGTCGACCCATTTAGCTTTGTTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAAAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCTCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCTCACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCTGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGATTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACAAGGAGCAGGCTTAGGGACCCCGGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAA
Protein
MRALQRDVKSRIAEVRDARWSDFLERLAPSQRSYYRLTRTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPSTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWLIDINPAKSTAVLFQRGSSSRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRSRLRDPGNRTRRTRQRGRRAT

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    KQ459259    KPJ02068.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    GALX01005359    JAB63107.1    GALX01005299    JAB63167.1    KQ973342    KXZ75569.1    GGMR01019198    MBY31817.1    ABLF02042518    ABLF02057746    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02014862    ABLF02014866    ABLF02061908    ABLF02003961    ABLF02059872    GGMS01002955    MBY72158.1    GGMS01006359    MBY75562.1    RPOV01000134    RPJ78669.1    ABLF02033757    GBBI01004395    JAC14317.1    GGMR01018716    MBY31335.1    GFXV01007093    MBW18898.1    GGMS01000737    MBY69940.1    GGMR01003407    MBY16026.1    GFTR01008038    JAW08388.1    GBBI01001646    JAC17066.1    GGMS01017914    MBY87117.1    GGMR01000676    MBY13295.1    GGMR01016114    MBY28733.1    NEVH01006736    PNF36716.1    GGMS01008766    MBY77969.1    S59870    AAB26437.2    ABLF02008463    NEVH01000269    PNF43694.1    GEZM01038405    JAV81653.1    GEZM01053022    JAV74219.1    ABLF02034467    ABLF02021177    ABLF02027367    ABLF02066338    GBBI01004571    JAC14141.1    NEVH01020940    PNF20481.1    NEVH01017542    PNF24034.1    GGMS01012005    MBY81208.1    NEVH01006721    PNF37225.1    NEVH01020071    PNF21969.1    NEVH01010546    PNF32261.1    GGMS01017365    MBY86568.1    NEVH01003017    PNF40781.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02008153    ABLF02008462    ABLF02008464    NEVH01023962    PNF17612.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01007443    PNF35684.1    NEVH01018383    PNF23463.1    NEVH01026386    PNF14434.1    NEVH01005938    PNF38077.1    GGFJ01001857    MBW50998.1    AY060438    AAL25477.1    ABLF02024246    NEVH01022639    PNF18527.1    NEVH01001355    PNF42855.1    NEVH01002704    PNF41489.1    GFDF01007661    JAV06423.1    NWSH01000032    PCG80497.1    GGFJ01001858    MBW50999.1    ABLF02020655    ABLF02039168    ABLF02061060    GFTR01008262    JAW08164.1    GBGD01000880    JAC88009.1    NEVH01007838    PNF34986.1    GBGD01000799    JAC88090.1    ABLF02037660    NEVH01002716    PNF41415.1    NEVH01000280    PNF43672.1    NEVH01014858    PNF27387.1    NEVH01023961    PNF17613.1    NEVH01019964    PNF22161.1    GEZM01084969    JAV60363.1    GGMS01002992    MBY72195.1    NEVH01006754    PNF36554.1    GFTR01008251    JAW08175.1    NEVH01011985    PNF31054.1    GBBI01001570    JAC17142.1    NEVH01021205    PNF19912.1    GFTR01008256    JAW08170.1    GBBI01001642    JAC17070.1    NEVH01019080    PNF22876.1    PCG80496.1    NEVH01019376    PNF22596.1    NEVH01011193    PNF32021.1    NEVH01016302    PNF25823.1    GGMR01014053    MBY26672.1    NEVH01009134    PNF33528.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF10551   MULE
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
627
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
11.7222499999999
Exp number, first 60 AAs:
0.00405
Total prob of N-in:
0.45496
outside
1  -  627
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
25.025103
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号