SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08078
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS       + More
Probable RNA-directed DNA polymerase from transposon X-element      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.178
 

Sequence

CDS
ATGGTCAGGAACGACAGGCTCTCTACTCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCATCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTCGGCATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTACCCGCTAAATATCGCACATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGAGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGACTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACTCGGACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAGCTCCTAAGAGCCAAGAACGCCTCAATACGCGCCTACGACAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGTCTCCTTGCCACCCTCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCAAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCAGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAACGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGATCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTTAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCCAGTAGAAACAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACTCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATTAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCTTTACAATCCCGCTTTTGCAGGTTAGCCGTCGGAGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCTATCCAGAAATACATGAAGTCAGTGTCGGAACGGTACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTAGCCGCCGCTGACTACTCCCCGAATCCTGATCACGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGACGCCTTCAGCTCTAACACTAGGAGCAGGCTTAGGGACCTCGGTAACCGTACTCGTCGAACTCGACAAAGAGTTCGCCGTGCAACCTAA
Protein
MVRNDRLSTRGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLSLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNSDSTPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRVSLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRSLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPILWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIQKYMKSVSERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRSRLRDLGNRTRRTRQRVRRAT

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    GALX01005359    JAB63107.1    KQ971729    KYB24751.1    ABLF02042518    ABLF02057746    GBBI01004395    JAC14317.1    GGMR01018716    MBY31335.1    GGMS01006359    MBY75562.1    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    NEVH01021205    PNF19912.1    NEVH01011985    PNF31054.1    GBBI01004571    JAC14141.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    ABLF02034467    GGMR01000676    MBY13295.1    ABLF02024246    GFTR01008262    JAW08164.1    GFTR01008279    JAW08147.1    KQ973412    EFA12510.2    NEVH01006736    PNF36716.1    GEZM01053022    JAV74219.1    GFTR01008261    JAW08165.1    GGMS01002992    MBY72195.1    GGMR01003407    MBY16026.1    NEVH01017470    PNF24199.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GFXV01000908    MBW12713.1    NEVH01022639    PNF18527.1    NEVH01020940    PNF20481.1    LBMM01013518    KMQ85605.1    ABLF02023911    ABLF02028535    ABLF02028545    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    ABLF02041767    AY060438    AAL25477.1    GFTR01008038    JAW08388.1    AF237761    AAF81411.1    GFTR01008271    JAW08155.1    NEVH01026386    PNF14434.1    GFTR01008251    JAW08175.1    NWSH01007753    PCG62823.1    GGMS01017365    MBY86568.1    NEVH01016302    PNF25823.1    GFTR01008256    JAW08170.1    GGFJ01001858    MBW50999.1    GGMR01000226    MBY12845.1    GFTR01008257    JAW08169.1    GGFJ01001857    MBW50998.1    GGMR01003864    MBY16483.1    ABLF02017874    ABLF02027031    NWSH01000032    PCG80496.1    GGMR01016905    MBY29524.1    RPOV01000134    RPJ78669.1    GEZM01084969    JAV60363.1    KK119692    KFM76444.1    GGMS01000737    MBY69940.1    GGFL01004957    MBW69135.1    GGFL01005012    MBW69190.1    GFXV01002840    MBW14645.1    DNOY01000259    HBE18313.1    GFTR01008151    JAW08275.1    NEVH01005277    PNF39135.1    GGMR01006408    MBY19027.1    NEVH01019376    PNF22596.1    GBBI01003810    JAC14902.1    GECL01003538    JAP02586.1    S59870    AAB26437.2    GGMS01002955    MBY72158.1    NEVH01019963    PNF22185.1    GFTR01008260    JAW08166.1    GGMR01012676    MBY25295.1    GFTR01008246    JAW08180.1    ABLF02040174    ABLF02040183    ABLF02055266    KU543673    AMS38352.1    GGMR01016296    MBY28915.1    NEVH01026154    PNF14491.1    GBGD01000389    JAC88500.1    GFTR01008269    JAW08157.1    GGMR01006491    MBY19110.1    NEVH01005295    PNF38784.1    GGFJ01001844    MBW50985.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
858
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.58459000000002
Exp number, first 60 AAs:
0.06747
Total prob of N-in:
0.06627
outside
1  -  858
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
49.324936
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号