SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08071
Annotation
ORF_B_(bases_1850-5560)_first_start_codon_at_2306_[Autographa_californica_nucleopolyhedrovirus]
Location in the cell
Nuclear   Reliability : 2.571
 

Sequence

CDS
ATGGCCGTAGACCCGGACCAAATCTACAAGGCCCTTCGGCCAGTGCCAGAGTTCGACGGCAATCCGAACATACTGACTAGGTTTATCAGAATTTACCAAAGAGATGAGACCGCTTTATACAATGACCTCTCCTTACTAACACAGGGAAATAGTAGCCCCCAGGAGTTTTACGACAAATGCCAGACCCTATTCAGCACTCTCATGACATACGTAACTTTACACGAAAGTATTGCCACAACCATCGAGGCAAAACGCGACTTGTATAAAAAGCTAACAATGCAAGCATTTGTTCGAGGCCTCAAGGAACCCTTGGGATCTCGCATACGCTGCATGAGACCGACCTCCATTGAAAAGGCTCTGGAATTTGTACAGGAAGAACTTAACATAATGTATCTACAACAGCGAAACGGGTTCACCTCTGAACGGCGCAACCTTATTCAGCCTACACCGACACCACCTGTAAAGATACCACCTATGTTTCCGGTAGCAATGCCGAAACCGCTTTCATTCGGACCGAACCCAGGACCGAGCTGGGAGCGACAGCCACCACCAGGACTTAATAACCACTGGAAACCTGCTTTCAAATTTAACGTCCCTCAGCGCATGCCTAACATGCCATCACGCACGCAGCAAATGTTCGCATCGCACCCACCAAACTACAACCCCCGTAGCAACGTATTTAGGCTACCTCAGCGGAACCAGGGACCGAAACCTATGAGTGGTATTAGTCACTACGTGGCAAAACAACTTCCACTCACAGGTCATGATTGGACTTTTTCAGAACTTAACGACGCGGGACCTATTAAACTGTTTGTCTACGATTTCCACAAATTTTTTGACGGACTTATTGGTTTAGACTTGCTGACTAAATGGAAATCTAGAATGGACCTTAAAGACAACCTACTGATTACAGACAATTCTACCAACCCTATTGAAATGTTCAATTCTCGCAACGTCAACCTGTACGAAGACATCGTACCGGCTAACTCTATGGTCGGAGACATCAAAAAACGACCCGTTGTCAGTAAGCCATTTGAAACGCACACTCGCATATCCATACAAGTTTCCCAATCAAACTTAAGAGAAGACGTCATAAACGCCATTAAAGAATTCGTTAATCCTAAAGTAAAAACTGGCCTCCTTATTAATCCAACATTAAGCATGTACGACATTATACCCATAATTCAAGACACGTTCAGAAATTCGGCAATGAACCTCCTACTCACAAAGGTCGAATTAGAAAATGTGAAAGAGTACCTTCGGCAACAAGAAATAATAAGCCACTATCACGATGGAAAAACTAACCACCGCGGAATAAACGAGTGTTATTTAGCTCTTTCGCGAAAATATTACTGGCCGAAAATGAAAGATCAAATTACAAAATTCATAAACGAATGTACTATATGCGGACAAGCTAAATACGATCGCGCACCCATTAAACAGCAGTTTAGCATAGTACCACCCCCGAAGAAACCCTTCGAAATAGTTCATATGGACTTGTTCACCGCCCAATCCGAAAAATACCTGACATTTATTGACGTATTCTCTAAGTACGGACAGGCTTACCTGTTGAGAGACGGCACAGCAATTAGCGTATTACAGGGTCTATTGCAGTTCTGCACGCATCATGGTCTACCTTTAACGATAGTAACTGATAATGGTACAGAATTCACAAACCAATTGTTTTCCGAATTCATACGACTTCACAAAATAAATCATCATAAAACCCTAGCACATACACCTAATGACAATGGCAATGTAGAGAGATTCCGTTCAACCTTGCTAGAACACCTTCGCATACTTCGCTTACAACATAAAAATGAACCTGTAATAAACTTAATGCCTTATGCAATATTAGCTTACAACAGTTTAGTTCACAGTTTCACCAAATGTCGCCCTTTTGACATCATAACGGGACACTTTGACCCTAGAGACCCTCTCGACATCGACATAACAGCCCATTTACTGCAGCAGTACATGGAATCACATAAAGCTCAAATGACTACAGTTTATGAACTCATAAATGAAACCTCACTTGCTAACCGTACATCTCTCATTGAAAATAGAAATAAGGACCGCGAACCAGAAGCGACGTACCAGCCTAACCAACAAGTTTTCATTAAAAATCCGATAGCAGCCCGACAAAAAACAGCCCCGAGGTACACTCAAGATAGAGTGTTAGCAGACTTACCAATTCATATCTACACATCGAAAAAACGAGGCCCTATTGCTAAATCCCGACTTAAACGTGCACATAAAGACTTCCGATTGTTACAGGATTCTACTGAACCTCCTGACCCGACATCTGACGACCGCACACGAGATAAAACTTGA
Protein
MAVDPDQIYKALRPVPEFDGNPNILTRFIRIYQRDETALYNDLSLLTQGNSSPQEFYDKCQTLFSTLMTYVTLHESIATTIEAKRDLYKKLTMQAFVRGLKEPLGSRIRCMRPTSIEKALEFVQEELNIMYLQQRNGFTSERRNLIQPTPTPPVKIPPMFPVAMPKPLSFGPNPGPSWERQPPPGLNNHWKPAFKFNVPQRMPNMPSRTQQMFASHPPNYNPRSNVFRLPQRNQGPKPMSGISHYVAKQLPLTGHDWTFSELNDAGPIKLFVYDFHKFFDGLIGLDLLTKWKSRMDLKDNLLITDNSTNPIEMFNSRNVNLYEDIVPANSMVGDIKKRPVVSKPFETHTRISIQVSQSNLREDVINAIKEFVNPKVKTGLLINPTLSMYDIIPIIQDTFRNSAMNLLLTKVELENVKEYLRQQEIISHYHDGKTNHRGINECYLALSRKYYWPKMKDQITKFINECTICGQAKYDRAPIKQQFSIVPPPKKPFEIVHMDLFTAQSEKYLTFIDVFSKYGQAYLLRDGTAISVLQGLLQFCTHHGLPLTIVTDNGTEFTNQLFSEFIRLHKINHHKTLAHTPNDNGNVERFRSTLLEHLRILRLQHKNEPVINLMPYAILAYNSLVHSFTKCRPFDIITGHFDPRDPLDIDITAHLLQQYMESHKAQMTTVYELINETSLANRTSLIENRNKDREPEATYQPNQQVFIKNPIAARQKTAPRYTQDRVLADLPIHIYTSKKRGPIAKSRLKRAHKDFRLLQDSTEPPDPTSDDRTRDKT

Summary

Uniprot
ProteinModelPortal
PDB
3S3O     E-value=1.00524e-06,     Score=129

Ontologies

Topology

Length:
777
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0887999999999999
Exp number, first 60 AAs:
7e-05
Total prob of N-in:
0.00142
outside
1  -  777
 
 

Population Genetic Test Statistics

Pi
20.238567
Theta
30.997925
Tajima's D
-1.223544
CLR
31.702561
CSRT
0.0987950602469877
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号