Gene
KWMTBOMO08068 Validated by peptides from experiments
Pre Gene Modal
BGIBMGA014545
Annotation
PREDICTED:_cubilin-like_[Bombyx_mori]
Full name
Cubilin homolog
+ More
Cubilin
Probable cubilin
Tolloid-like protein 2
Tolloid-like protein 1
Dorsal-ventral patterning tolloid-like protein 1
Bone morphogenetic protein 1
Deleted in malignant brain tumors 1 protein
Dorsal-ventral patterning protein tolloid
Neurogenic locus notch homolog protein 1
Neurogenic locus notch homolog protein 4
Neurogenic locus notch homolog protein 2
Protein lin-12
Neurogenic locus notch homolog protein 3
Protein eyes shut homolog
Protein jagged-1b
Protein jagged-1a
Fibropellin-1
Protein crumbs homolog 2
Protein jagged-1
Neurogenic locus Notch protein
Protein jagged-2
Protein glp-1
Sushi, nidogen and EGF-like domain-containing protein 1
Protein crumbs
Protein serrate
Delta-like protein 1
Protein crumbs homolog 1
Growth arrest-specific protein 6
Delta-like protein A
Sushi, von Willebrand factor type A, EGF and pentraxin domain-containing protein 1
Delta-like protein D
Delta-like protein C
Neurogenic locus protein delta
Stabilin-1
Stabilin-2
Thrombospondin-4
Cubilin
Probable cubilin
Tolloid-like protein 2
Tolloid-like protein 1
Dorsal-ventral patterning tolloid-like protein 1
Bone morphogenetic protein 1
Deleted in malignant brain tumors 1 protein
Dorsal-ventral patterning protein tolloid
Neurogenic locus notch homolog protein 1
Neurogenic locus notch homolog protein 4
Neurogenic locus notch homolog protein 2
Protein lin-12
Neurogenic locus notch homolog protein 3
Protein eyes shut homolog
Protein jagged-1b
Protein jagged-1a
Fibropellin-1
Protein crumbs homolog 2
Protein jagged-1
Neurogenic locus Notch protein
Protein jagged-2
Protein glp-1
Sushi, nidogen and EGF-like domain-containing protein 1
Protein crumbs
Protein serrate
Delta-like protein 1
Protein crumbs homolog 1
Growth arrest-specific protein 6
Delta-like protein A
Sushi, von Willebrand factor type A, EGF and pentraxin domain-containing protein 1
Delta-like protein D
Delta-like protein C
Neurogenic locus protein delta
Stabilin-1
Stabilin-2
Thrombospondin-4
Alternative Name
460 kDa receptor
Glycoprotein 280
Intrinsic factor-cobalamin receptor
Intrinsic factor-vitamin B12 receptor
Intestinal intrinsic factor receptor
Metalloprotease xolloid
Xenopus tolloid
Metalloprotease xolloid-like
Xenopus tolloid-like protein 1
Xlr
Chicken tolloid-like protein 1
Metalloprotease colloid
Mini fin protein
Mammalian tolloid protein
Procollagen C-proteinase
Apactin
CRP-ductin
Glycoprotein 300
Hensin
Mucin-like glycoprotein
Vomeroglandin
p80
Motch A
mT14
p300
Translocation-associated notch protein TAN-1
Abnormal cell lineage protein 12
Motch B
Epidermal growth factor-like protein 10
Epidermal growth factor-like protein 11
Protein spacemaker homolog
Jagged3
Epidermal growth factor-related protein 1
Fibropellin-I
SpEGF I
UEGF-1
Crumbs-like protein 2
Insulin-responsive sequence DNA-binding protein 1
Secreted protein SST-3
Stromal nidogen extracellular matrix protein
95F
Protein beaded
Drosophila Delta homolog 1
AXL receptor tyrosine kinase ligand
After eight protein
Fasciclin, EGF-like, laminin-type EGF-like and link domain-containing scavenger receptor 1
MS-1 antigen
CCP module-containing protein 22
Polydom
Selectin-like osteoblast-derived protein
Serologically defined breast cancer antigen NY-BR-38
Fasciclin, EGF-like, laminin-type EGF-like and link domain-containing scavenger receptor 2
Glycoprotein 280
Intrinsic factor-cobalamin receptor
Intrinsic factor-vitamin B12 receptor
Intestinal intrinsic factor receptor
Metalloprotease xolloid
Xenopus tolloid
Metalloprotease xolloid-like
Xenopus tolloid-like protein 1
Xlr
Chicken tolloid-like protein 1
Metalloprotease colloid
Mini fin protein
Mammalian tolloid protein
Procollagen C-proteinase
Apactin
CRP-ductin
Glycoprotein 300
Hensin
Mucin-like glycoprotein
Vomeroglandin
p80
Motch A
mT14
p300
Translocation-associated notch protein TAN-1
Abnormal cell lineage protein 12
Motch B
Epidermal growth factor-like protein 10
Epidermal growth factor-like protein 11
Protein spacemaker homolog
Jagged3
Epidermal growth factor-related protein 1
Fibropellin-I
SpEGF I
UEGF-1
Crumbs-like protein 2
Insulin-responsive sequence DNA-binding protein 1
Secreted protein SST-3
Stromal nidogen extracellular matrix protein
95F
Protein beaded
Drosophila Delta homolog 1
AXL receptor tyrosine kinase ligand
After eight protein
Fasciclin, EGF-like, laminin-type EGF-like and link domain-containing scavenger receptor 1
MS-1 antigen
CCP module-containing protein 22
Polydom
Selectin-like osteoblast-derived protein
Serologically defined breast cancer antigen NY-BR-38
Fasciclin, EGF-like, laminin-type EGF-like and link domain-containing scavenger receptor 2
Location in the cell
PlasmaMembrane Reliability : 2.164
Sequence
CDS
ATGAACAGAAAATTAATCAATCTGCAACGAGAATTAGCACTGTTACGCGTGGATCAATGTCGCTTACAACCTTGCATGCATGGAGGAATATGTTTGAGCATATTAGATGGTTATCACTGCCTTTGCCCATCAAACTGGGAAGGACAAAATTGTGATATTGACGTCAACGAATGTCATAACTTTGCTGGTACAGACCTTGGTTGTCAGAATGGCGCAACTTGTATTAACAGACCAGGTTCATATGAATGTCTTTGTAAATCTGGCTGGTATGGCTTACATTGCACTAGAAAAGCTAAAGATTGTTCTGGAGGAGACTTCGAAATGTGTGGTCACGGTACGTGTGTTCCAGTTACAACAGGTCAAGGCGTTAAATGTATTTGTGACCAAGGCTGGACTACAAATGGAACCGATTTTTCTTGTCTCACGGATGTAAATGAATGTGAAGCAAGTCAGGGTCCCAGATGTTCAGTGAATCCAAAAGTAGAATGTATTAACTTACCAGGCTCATTTCGCTGTGGACAATGTCCACCTGGCTATCAGGGAGATGGTTACAGTTGTTCTGATATCGACGAATGTAGTACTATACCAAACGGAGGCTGCAGTCCAGTCGCAGCATGCCACAACACAATCGGATCGCGAATATGCGGCCCTTGTCCGCTTGGCTTCCAAGGCGACGGTGTTTCATGTTCTTGGAAAGGATCTTGCAACCTCGACCACGGAGGCTGCCATCCTTCTGCACAGTGCATCGACAATGGAAGAATGGGCGGTGCGGGCGCGCAGTGCATATGCCCCGAAGGAATGGAAGGTGATGGTTACGGTCTCAATGGCTGTTTTATCTCGAATGGAGGAAATCAAAGCTGCGCAAGTAGACCCTGTGGACTCAATGGGCGATGCCACACGTTACGTACAGGATACACTTGCGTTTGTCGTAAAGGTTTCAGTGGAGCTCATTGTGAAGTGCCAAGTAACTTATGCGCAAACAATCCATGTCTCAACGGAGGGGTATGTAGACTAGACGACCAAAATCCCAGAGGCTTTAGGTGTGAATGCACAGCACAGTATTCCGGACCAATTTGTCAACTAGTGTCCAAACGATGCGGCGGGGTACTTGATAATAACGAAGGTACTATTTCATATCCTGTTGCAAACACAACATACAACAATAACGCACGATGTGCATGGGTAATTCATACAAATCCGGATAAAGTAATTAACGTAACATTTACCAAATTTTATTTAGAATCTCATCCTGATTGTTTGTATGACTTTCTGCAAATACACGACGGACGAAGCTCTGCCAGTCAACTTTTAGGTAGATTTTGTGGTAACGAATTCCCTAAGGGCGGTAATATAATATCAAGCCATAACAATTTATATTTATGGTTTTCGTCTGACGCTACTGTAGCCAAAAATGGATTTACACTTCATTGGATTAGTGTGAAACCGATTTGTGGAGGCGATGTAGATGTTACGAAACATGGACAAATAAGTTCTCCTGGTTCACCAGGAAAATATCCCCCTAACCGCGACTGCTACTGGCACTTATCGACTACGTTAGAGAGACCCATAGCTCACAAGTGTACTCTCGGAGATTATTTAGAACTGAGGAATGGAGTTACAGAAAATTCACCAATCATAGATCAATTATGCGGCAACTTTGAGAAAAGAATAATTCTGTCCATGGCGAACGCTTTATATATTCGTTTCCATTCTGATTTTTATCTTTCTGGTAAAGGATTCAAATTAGAATGGGATGGAACCGTCATTGGATGTGGTGGCACTGTTACTAGTTCTAAAGGATCTATAGCTTCTCCAAACTATCCTAACAATTACCACGACTTCCAAGAGTGCTTTTATAAAATTGTTGCTAGCCCAGGTTCAAGAATTCATATTTCGTTTGTAGAGCTAGATCTCGAACGGACTCACGAGTGTGAAGACGATTACATTGAAATATACGACGGTCTTGATTCTAGCGCTAATAAGTTAGGACGATTTTGTACAATGTCCCCTGAATTAGTAAACATCGCAACTTCTTCCAATAGTGCATATTTAAAGTTTCGTTCTGACTTTTACCTAAGTGGTAAAGGATTTTTATTGAATTATGAAGCCGCCTGTCATAATAATATCACTGGAAATTACGGAGTTATAGAAACGCCAAATTTTCCCGGTTTCTATCCAGCTAATTCTAATTGTCTGTGGAATATAACCGTATCGAAAGGAAATCGGATAAATGTTACTTTCACGGATTTCAATCTATATAAACCCTACCGAGGTTATCCTTTTTCACGTTTAAATACGTTCTACAGATACCAAACTTGTCAGCATGATTACATACAAATTAAGGACTCAGCTGATTCAACTTTCTCCGATAAAATCTGTGGAAATAAAATACCTTCAATGATAACTACTAAAGAGAACTCGCTACAAATTAAATTTTTTTCTGGATACGTTCCGCGAACCGGCTTCCGTCTCGAATGGGTTAGATTTGGATGCGGTGGTGTTGTTCGTGCATCAAACGGAATTTTAGAACTGGAAAAACGTTTCATGTCGAGTAAAGAATTGGAATGTGAATGGACTATAAGAACTTCCATCGGGAAATCATTAATTTTAAACTTTAGCGACATTTACTTATCGGAGACTAAAGATTGTACAGAAGATGCTATAGAAGTGTATAACGGTGAAGATACTACATCGCCACTATTAACCAAAATATGCAGTCGAAAACCAACGTCCGTGCAATCTACAGCCAACGTTATGTTTGTAAGATTAAGCAAGCTCTCATCTCTCAAAGATGTTTATTTTAAATCCAAATATCGTTCTATAGCATCGACGTGCGGTGGCTCAATAAAATCTACTTCAGGATTTATTTATTCTAAAAACTACCCCAAGAATTACGATAACAATTTAGATTGTTTATGGAAGATTGAAGTAGCCAAGGATCATCGAATTGCATTGAATTTTACAGACGTAGATTTATACTCCGAAAACGTTGCTCCTGGCCATGATTGTAACGACCGAATCGAAGTATACGATAATATGTTTAATATGCTTACAAAAACATACAAATATCATATCTGTTCTCGGTCCGATACAAAATCTTTTGTCAGTGATTCAAACACGATTTACGTTAAATTTGTTACTGATAACGTAGGAACAGCTAAAGGATTTAAAGGCAATTTTAATACTGTTTGCGGAAGCTCTATTACCGCCATCACCGACGGAACTATTTCAAGCGATAAACACCCGTATTCGAATAGCTGCAGCTGGACAATTAAAGCATCAGATTTAGATAAAAAAATATCGTTATCATTAACTCATATAGCACTACCAACCGATTTTAGTAATTTTATTAATAGAACCTGCTCTTCGACATACCTTCGTCTATACGATGGGGATGACACTAATGCGCCGGAGATAGGAGAATACTGCGGACGAAAAATACCTCCACTAATAGTAAGTCATGGAAGCGCTATCACCATGGAACTGGGGACGTACAGTAATAAAATTGAAGGGGAATTTTCTGCACACTATTCGACGTTATCTAATGCATGTGGAGGAACGTACACTTCCGAAGAGGGAGCACTAGCATCACCGAACTATCCCCGCCCTTACCCATCAGGCGTTGATTGTGAATGGATAATAAAAGCATCGCCTGGTAATCAGATATACATCACATTCGAAAGTTTTAATTTAGAATTTTCTGAAGCATGTAATGAGGATTATTTAGAATTACGTGAAAATTCTGGTAGCGGACAATTACTTGATGTATACTGTGGCAATGATATTCCATCAAATGTTACAATTGGAAATAAATTGTACATCAAATTTCACAGTAAAATGCAAAGTACTGTGAAAACTAATGGTTTCCTTATTCATTATGGATTACTGCATAATAATGAAATCACAGGTGATCATGGAAGAATTACGTCACCGCTGTATCCAAATCTTTACCACGATTCTGGTGATTTCACTTGGCGAATAATCACAACCGCACGTAAAACTATTTCAATAAAATTTGACACCTTGAACATTCCAACGTATGGTGATATTTGTTTTAACAAGCTAAGTATTTACGATGGATATGATAGTTCGGGACGCCTTTTAACAGAACTTTGTGGAGTAACCCTTGAATCGGACACATTTGAAACATCCTCAAATGCCATTTTCATTAAATTTTCCCTGGACGGATCTAACACAGGATCACTATTTAGTTTAACGTGGACAAGTTCCGATAAAATAATGATCAATGAAGATGAAAATGAAATCATTAATTGCGGATCTAACGAAACGCAAACATTGTTACCTGGTGAGATTAAGATAATTAAATCGCCAAATTATCCAAATCCGTATGACATTGATCTAAACTGTAAATGGGAATTCAAAGGTACTTTAGGAAATCATCTTAAGATCTCTTTTATAGATTTTAACTTAGAAGAAACAAGCAAATGTTTTGCCGACTACGTTTCTATATTTTCAGCGGATAAAATCAATGACTGGAAACCAATTAAAGAGGGGCAGTGCTTATCTGATTCAATGAAAGGTGATATAAACGCCACAGATTATTTAAAAGTTGTTTTCGTTAGTGATCGTACCGTAAACAAAAAAGGATTTTTAGGTAAAGTGGCTTCAGTATGCGGTGGACTAATAACTGACCTTTCTGGAACCTTTGGACCAGTTTTAGCTGATATTATAAACATTGAATATCCAAATTATAGGTGTGATTGGACTGTAAAAGTACGACCGGGTAGAGTCATAAAAGTTTTATTTGAACATTTTAATATAACAAGTAATGACTGTTCAACTTCGGTGATTTTACATAACGGCGATTCAATTTATGCTCCTATGTTAGGAAGTGGAAAATACTGTGGGCTTGAACACGAAATCAAGGAAAATTTAGTTACTTCAAGTAATACGTTATATGTCAGTTACGTGACCAAGAACTCTTGGAGCAGACTTTCATCCAAATTTGAAAATTTTATTATTCATTACGAAGAACATAGTATAGAGTGCGGATTTACTTCGAAATTGGATCAAGATCAAGCATGGGAAATCATAAATTCCCCGAACTACCCAGCAGTTCCTCAACCATATACAGAGTGTGGTTGGACTATAACTGGGCCTGCTGGTGAAATTTTGAGAGTTGATTTTATAGAAAGGTTTGATTTGGACAACGTAAATAACTGCGAAACGGAATCGGTAGAAATATATGATGGTAGTTCAGCATTGGCTCCTTCCCTAGGCAGATTTTGTCAAGATAAACCTGCAACTGTGAAAACAAAAAGCAATACAGTGTTTGTTCAATATTTTACACAGCTTGCAGAACCAAGGAATGGATTCAAAGCCAACATATCTATTGATGTTTGTGGTGGCACGATAATAGCATCGTCAGGAGAGATTTTATCTCCAGGATATCCTCACTTGCAAATTTTACCTTACGGCACTGAATGCAAGTGGGAAATAATAGGAACGCCTACGAGAATTTTACATTTAAATCCTCAAGACATACAACTACCAGAATCCGAAGCTCCGTGTGCTACTTACATAACAGTCGAGGAAACAATCGTTGCTAATAACACAATTGTTATATTACAAAAATTCTGCAATGATGCTGTTCAACACAATTTGTCTCCAATAGAATCTACCTCAAACAAAATAGTCATTAGACTACATATCGGGAAACCTAGTCAATGGATACAAATTTCAGAGCATAGAGGTTTCAAATTTACTTTTAATACTTCACAACCAACGTGTGGTGGCACAATTACGATACCTGAAGGCTTTTTAACGACACCTAGGTACCCCATGGAAACTTCTTTAAAATATTGTCAGTGGAAAATCGAAGTTCAAAAAAATCGTCGAATACGACTAGAAATCATAGATGCTGACACGCAGAAATTAATAATAAGCATGTATAACGATAACAAATTTCAGTCTTTAATAAGCATACTCTCAGGAGAAGAAAATAACACTGCAAGCCAAATTTTCGAATCATCCGGCAATCAATTATCTTTTTATATATGGTTAAAATCTACGAAAACTCAGTATCGGTTTAAAGCTAAGTTTAGTTCTGATGAACCTTCTTTATGTGGTGATGAACTTCAAGGATTAAAAGGCAGCATAACCTCTCCCGATATAAACAGATCTTATGCTTGTGAATGGCATTACAACTCCGCAGGAGTAATTCTAAATGAAACTTATAAATATTCGACGACCCTTATAAAAATCAACATGACTTCGTCTGTGTCTAGAACACATTGTAGATATTTCGATCCTAAGCTAATGATTGCATCCAAGTCTGTGAGCTTTAGTAAATCAATTTGTGGTAATACCATAACATCCTTAAAAATACCTCTACCTTCTTTCGATTTGAAAGCATTCAAAGGAAACATGAAATCATTAGATTTTACGGTATCCTGGGAATTACAACCATGCGGCGGTATAGTTCATGTGACTGAAAATCCAACTAATATTATTGATGTACCTGGGTCTTATGGTAGTACGATAGATTGTGCATGGCAACTGTCAATTAATGCTAACAACAGAATCCAGATAAATCTAGAAGGTACGTTTAACTTGGAGTGTGATGATGAATATATAAAAGTTTCTCGAGATCTTTCCCAAAACTCTCAAGTGATTGGTGATTTTTGTAAAAGTAATGCATTGACGATACCAATTTTATCGAATTTGAATAATGTTTATGTACAGTACCATTCAAAAGTAAAAAGTAATACAAATATACGATTAATTGCTAAAACCGTTACTAATCAATGCGGTGGTGTTTTGTTTGATTACGAAAAAGTTTTTGCGTCCCCGAACTATCCGAAAAATCATGACGCTAATCTAGAATGTGTATGGGAGATCAAAGCTAACGTAGGAAATCGGGTTAATTTAAAGTTTATTGACCGATTTACAATTGAAGAAACACCAAACTGCACCAAAGACGCTGTTATTATTTATGATTGGAAAGATAATGAGTACCAGGAGATAGCAAAACTTTGTGGTCGTAATGTCCCTCTGTCATATAATTCGACCAACTACAAAATGAAGGTTGTTTTTCGAACAGATTCAGATATTAATCTCGATGGATTCAAAGCGCGTTGGGATCCAATATGTGGCGGCAATTTTATAGCCACAGAAAAAGAACAGTTTTTGTACAGTCCTAACTATCCAGATGAATATCCAAATCTTTTAAACTGCACATATGAAATTTCAGCGCCAGATAAAAAAACGGAAATAAAGTTTGTCGAATTTGAATTGGAAGGTAGCTACCCTGATTGCTCTTATGACAACTTAACTGTATCTTATGCTGAAACTTACGACTATTTCTCAGAAGTATACTGTGGAAAACAGAAACCTCCGATGATGATCGGCGACAAAATTAATCTAGAACTGAAATCCGATGAGTTTTTAACACAAAAAGGTTTCAAAATCGCCTTCAAAACCTTCGATTGTGGCGGCCATATAAACTCCACTACTATGATCAAATCTACCAGAACTGAAAAATATCACGAAAATATGAATTGTACTTGGATTATTAATGCCCCAAAAGATGAAATTGTGATAATTAAATTTATATACATCGATTTAGAGGACCACTATACTTGTCAAAACGACTACATTTCTGTGTATAATGGTCTTACAGATGATGAAGATAAACGCATAGCTTTGTTTTGCGGACTCATAAACAAAACTACAACCGTGAAAAGTACAGGAAATACAATGCTTGTACAGTTCATTTCCGACAGTAGTATGGAGTTGACAGGATTCAAAGCTGAAGTTTATTTTGGTTTATCAGAAACTGTTGGATGTGGTGGAAAGATAGATTTGAGTGATGGTAAGGCTCGAACTGTCAAATCTCCCTTATTAAAAAACAGGGTAGTATATGAAAACTACTTGGATTGTGATTGGGCCATACAATCATTAGATGGTACTTATATAAAAATAGAATTTTTGTCATTTCACATTTCTCCGTGCGGCGACGTCAATCAAACTGCATTGGGCTACAGTAAGTGCGACTGTGATTATGTCGAAATTAAAGATGGAATTTATCCAAACAGTCTAATAATAGGAACATATTGTGGACATGTTATTCCAAGTCCGGTAATATCATCAGGAAACCAAATGAGCATCAAACTCATCACCGACGGAGAAATAGCCAGCTCGGGCTTTGAAGCCAAACTGACTGTGCTACCAACTATTTGTGGTCAATCACATTACGTTGTTAAAGAAACTAGGACGGAGATAAAATCTCCTGGTTATGATATAGGTTCCATTCCACGTGGAACACATTGTATGTACATCCTAGATGCCGGCGATAACCCTTATACAACAGTACGTTTGTCTATCACTACCGACTTACAACCTGTTAATGTTCAATCAAAACGCTGTACCGGAGACAAATTATTGATTACGTACTATAATAGCAACAGTAACGCTACACTTGGAAAAGATTTCATACTACACACTGAAACGACCGATTTCTTTTCACGTTCATCTTTGTATGACCTTACCGTTCCTACAAAGTTTGAATTGTGCGGTCATCAGAAAACATATGACATCTACGTCACCGGAAGCGTATCAATAAATTTAATAACATCTCCGGTGTCCGATTCATTAATTCATAGAGGGGTAAAAATAGATTTCTCATATGCAAGCTACTGCAGCCGAAACTACACCGGGATACAGGGCAGGATAAAAACAGATCACGATGCCCAATATGAGAACATTCATGATTGCTATACACTCATAACCGCACCGGAAAATCATACAATATCACTATACTTTATTAATGTTATACCAAATTATTGGGACGAAAACAGTTTTCTTAGTATATACGACGGCAATAACACGAGCTCACCAAAAATATTAACTATAAATACAATTTACACTGACGCTTCCGTGTTTTCATCGGGCAATTATGTTTTATTACACAATCATCAATCTGATGAGACGCATGCAATTTACGACAGAATCACTTTCGATCTAAATTACGTGGCAACAGATAAAGGTAGGGGTTGTGGCGGTAAGCTGAGTAATGAAATCGGCAAAATAACAAGTCCCCTTTATCCGGAAATCTATAGGCGCCGATCCACATGTGAATGGGAACTCGAGACACCTCCGGGTACACAGCTGGTACTAAGATTTGAAACATTCGATATGGGGATTAACTGTGATGAAAATTATATCCAATTGGTTGATAGTAAAGGTACTATATTATCGTCGTATTGTTCTGAAACACCAGCCGATTTCACTAGTCAAGACAATTATGTTAAAGTCGTAATGTATTCGACTGTTAATAATGGCGGCACCGGTTGGGTCGCTCTCTTCGCTGGCATCGAGGCCGTCTAA
Protein
MNRKLINLQRELALLRVDQCRLQPCMHGGICLSILDGYHCLCPSNWEGQNCDIDVNECHNFAGTDLGCQNGATCINRPGSYECLCKSGWYGLHCTRKAKDCSGGDFEMCGHGTCVPVTTGQGVKCICDQGWTTNGTDFSCLTDVNECEASQGPRCSVNPKVECINLPGSFRCGQCPPGYQGDGYSCSDIDECSTIPNGGCSPVAACHNTIGSRICGPCPLGFQGDGVSCSWKGSCNLDHGGCHPSAQCIDNGRMGGAGAQCICPEGMEGDGYGLNGCFISNGGNQSCASRPCGLNGRCHTLRTGYTCVCRKGFSGAHCEVPSNLCANNPCLNGGVCRLDDQNPRGFRCECTAQYSGPICQLVSKRCGGVLDNNEGTISYPVANTTYNNNARCAWVIHTNPDKVINVTFTKFYLESHPDCLYDFLQIHDGRSSASQLLGRFCGNEFPKGGNIISSHNNLYLWFSSDATVAKNGFTLHWISVKPICGGDVDVTKHGQISSPGSPGKYPPNRDCYWHLSTTLERPIAHKCTLGDYLELRNGVTENSPIIDQLCGNFEKRIILSMANALYIRFHSDFYLSGKGFKLEWDGTVIGCGGTVTSSKGSIASPNYPNNYHDFQECFYKIVASPGSRIHISFVELDLERTHECEDDYIEIYDGLDSSANKLGRFCTMSPELVNIATSSNSAYLKFRSDFYLSGKGFLLNYEAACHNNITGNYGVIETPNFPGFYPANSNCLWNITVSKGNRINVTFTDFNLYKPYRGYPFSRLNTFYRYQTCQHDYIQIKDSADSTFSDKICGNKIPSMITTKENSLQIKFFSGYVPRTGFRLEWVRFGCGGVVRASNGILELEKRFMSSKELECEWTIRTSIGKSLILNFSDIYLSETKDCTEDAIEVYNGEDTTSPLLTKICSRKPTSVQSTANVMFVRLSKLSSLKDVYFKSKYRSIASTCGGSIKSTSGFIYSKNYPKNYDNNLDCLWKIEVAKDHRIALNFTDVDLYSENVAPGHDCNDRIEVYDNMFNMLTKTYKYHICSRSDTKSFVSDSNTIYVKFVTDNVGTAKGFKGNFNTVCGSSITAITDGTISSDKHPYSNSCSWTIKASDLDKKISLSLTHIALPTDFSNFINRTCSSTYLRLYDGDDTNAPEIGEYCGRKIPPLIVSHGSAITMELGTYSNKIEGEFSAHYSTLSNACGGTYTSEEGALASPNYPRPYPSGVDCEWIIKASPGNQIYITFESFNLEFSEACNEDYLELRENSGSGQLLDVYCGNDIPSNVTIGNKLYIKFHSKMQSTVKTNGFLIHYGLLHNNEITGDHGRITSPLYPNLYHDSGDFTWRIITTARKTISIKFDTLNIPTYGDICFNKLSIYDGYDSSGRLLTELCGVTLESDTFETSSNAIFIKFSLDGSNTGSLFSLTWTSSDKIMINEDENEIINCGSNETQTLLPGEIKIIKSPNYPNPYDIDLNCKWEFKGTLGNHLKISFIDFNLEETSKCFADYVSIFSADKINDWKPIKEGQCLSDSMKGDINATDYLKVVFVSDRTVNKKGFLGKVASVCGGLITDLSGTFGPVLADIINIEYPNYRCDWTVKVRPGRVIKVLFEHFNITSNDCSTSVILHNGDSIYAPMLGSGKYCGLEHEIKENLVTSSNTLYVSYVTKNSWSRLSSKFENFIIHYEEHSIECGFTSKLDQDQAWEIINSPNYPAVPQPYTECGWTITGPAGEILRVDFIERFDLDNVNNCETESVEIYDGSSALAPSLGRFCQDKPATVKTKSNTVFVQYFTQLAEPRNGFKANISIDVCGGTIIASSGEILSPGYPHLQILPYGTECKWEIIGTPTRILHLNPQDIQLPESEAPCATYITVEETIVANNTIVILQKFCNDAVQHNLSPIESTSNKIVIRLHIGKPSQWIQISEHRGFKFTFNTSQPTCGGTITIPEGFLTTPRYPMETSLKYCQWKIEVQKNRRIRLEIIDADTQKLIISMYNDNKFQSLISILSGEENNTASQIFESSGNQLSFYIWLKSTKTQYRFKAKFSSDEPSLCGDELQGLKGSITSPDINRSYACEWHYNSAGVILNETYKYSTTLIKINMTSSVSRTHCRYFDPKLMIASKSVSFSKSICGNTITSLKIPLPSFDLKAFKGNMKSLDFTVSWELQPCGGIVHVTENPTNIIDVPGSYGSTIDCAWQLSINANNRIQINLEGTFNLECDDEYIKVSRDLSQNSQVIGDFCKSNALTIPILSNLNNVYVQYHSKVKSNTNIRLIAKTVTNQCGGVLFDYEKVFASPNYPKNHDANLECVWEIKANVGNRVNLKFIDRFTIEETPNCTKDAVIIYDWKDNEYQEIAKLCGRNVPLSYNSTNYKMKVVFRTDSDINLDGFKARWDPICGGNFIATEKEQFLYSPNYPDEYPNLLNCTYEISAPDKKTEIKFVEFELEGSYPDCSYDNLTVSYAETYDYFSEVYCGKQKPPMMIGDKINLELKSDEFLTQKGFKIAFKTFDCGGHINSTTMIKSTRTEKYHENMNCTWIINAPKDEIVIIKFIYIDLEDHYTCQNDYISVYNGLTDDEDKRIALFCGLINKTTTVKSTGNTMLVQFISDSSMELTGFKAEVYFGLSETVGCGGKIDLSDGKARTVKSPLLKNRVVYENYLDCDWAIQSLDGTYIKIEFLSFHISPCGDVNQTALGYSKCDCDYVEIKDGIYPNSLIIGTYCGHVIPSPVISSGNQMSIKLITDGEIASSGFEAKLTVLPTICGQSHYVVKETRTEIKSPGYDIGSIPRGTHCMYILDAGDNPYTTVRLSITTDLQPVNVQSKRCTGDKLLITYYNSNSNATLGKDFILHTETTDFFSRSSLYDLTVPTKFELCGHQKTYDIYVTGSVSINLITSPVSDSLIHRGVKIDFSYASYCSRNYTGIQGRIKTDHDAQYENIHDCYTLITAPENHTISLYFINVIPNYWDENSFLSIYDGNNTSSPKILTINTIYTDASVFSSGNYVLLHNHQSDETHAIYDRITFDLNYVATDKGRGCGGKLSNEIGKITSPLYPEIYRRRSTCEWELETPPGTQLVLRFETFDMGINCDENYIQLVDSKGTILSSYCSETPADFTSQDNYVKVVMYSTVNNGGTGWVALFAGIEAV
Summary
Description
Required in the nephrocyte for normal uptake of proteins and elimination of toxins, and for maintenance of endocytic trafficking structures. May function together with Amnionless.
Cotransporter which plays a role in lipoprotein, vitamin and iron metabolism, by facilitating their uptake. Binds to ALB, MB, Kappa and lambda-light chains, TF, hemoglobin, GC, SCGB1A1, APOA1, high density lipoprotein, and the CBLIF-cobalamin complex. The binding of all ligands requires calcium. Serves as important transporter in several absorptive epithelia, including intestine, renal proximal tubules and embryonic yolk sac. Interaction with LRP2 mediates its trafficking throughout vesicles and facilitates the uptake of specific ligands like GC, hemoglobin, ALB, TF and SCGB1A1. Interaction with AMN controls its trafficking to the plasma membrane and facilitates endocytosis of ligands. May play an important role in the development of the peri-implantation embryo through internalization of APOA1 and cholesterol. Binds to LGALS3 at the maternal-fetal interface (By similarity).
Cotransporter which plays a role in lipoprotein, vitamin and iron metabolism, by facilitating their uptake. Binds to ALB, MB, Kappa and lambda-light chains, TF, hemoglobin, GC, SCGB1A1, APOA1, high density lipoprotein, and the CBLIF-cobalamin complex. The binding of all ligands requires calcium. Serves as important transporter in several absorptive epithelia, including intestine, renal proximal tubules and embryonic yolk sac. Interaction with LRP2 mediates its trafficking throughout vesicles and facilitates the uptake of specific ligands like GC, hemoglobin, ALB, TF and SCGB1A1. Interaction with AMN controls its trafficking to the plasma membrane and facilitates endocytosis of ligands. May play an important role in the development of the peri-implantation embryo through internalization of APOA1 and cholesterol. Binds to LGALS3 at the maternal-fetal interface.
Cotransporter which plays a role in lipoprotein, vitamin and iron metabolism, by facilitating their uptake.
Protease which specifically processes prolysyl oxidase and maybe also chordin. Required for the embryonic development. Predominant protease, which in the development, influences dorsal-ventral patterning and skeletogenesis. In embryos, inhibits the development of dorsoanterior structures and ventralizes activin-induced dorsal mesoderm in animal caps.
Protease which processes procollagen C-propeptides, such as chordin. Required for the embryonic development. Predominant protease, which in the development, influences dorsal-ventral patterning and skeletogenesis.
Protease which processes procollagen C-propeptides, such as chordin, probiglycan and prolysyl oxidase. Required for the embryonic development. Predominant protease, which in the development, influences dorsal-ventral patterning and skeletogenesis (By similarity).
Required for patterning ventral tissues of the tail. May increase bone morphogenetic protein (BMP) activity at the end of gastrulation by proteolytic cleavage of chordin and release of BMP from inactive complexes.
Protease which processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Required for the embryonic development, especially heart development. Predominant protease, which in the development, influences dorsal-ventral patterning and skeletogenesis.
Cleaves the C-terminal propeptides of procollagen I, II and III. Induces cartilage and bone formation. May participate in dorsoventral patterning during early development by cleaving chordin (CHRD) (By similarity). Responsible for the proteolytic activation of lysyl oxidase LOX.
May play roles in mucosal defense system and cellular immune defense. May play a role in liver regeneration. May be an important factor in fate decision and differentiation of transit-amplifying ductular (oval) cells within the hepatic lineage. May function as a binding protein in saliva for the regulation of taste sensation. May play a role as an opsonin receptor for SFTPD and SPAR in macrophage tissues throughout the body, including epithelial cells lining the gastrointestinal tract (By similarity). Required for terminal differentiation of columnar epithelial cells during early embryogenesis. Displays a broad calcium-dependent binding spectrum against both Gram-positive and Gram-negative bacteria, suggesting a role in defense against bacterial pathogens. Binds to a range of poly-sulfated and poly-phosphorylated ligands which may explain its broad bacterial-binding specificity. Inhibits cytoinvasion of S.enterica. Associates with the actin cytoskeleton and is involved in its remodeling during regulated exocytosis. Interacts with pancreatic zymogens in a pH-dependent manner and may act as a Golgi cargo receptor in the regulated secretory pathway of the pancreatic acinar cell.
Functions as a receptor for membrane-bound ligands Jagged-1 (JAG1), Jagged-2 (JAG2) and Delta-1 (DLL1) to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs. Involved in angiogenesis; negatively regulates endothelial cell proliferation and migration and angiogenic sprouting. Involved in the maturation of both CD4(+) and CD8(+) cells in the thymus. Important for follicular differentiation and possibly cell fate selection within the follicle. During cerebellar development, functions as a receptor for neuronal DNER and is involved in the differentiation of Bergmann glia. Represses neuronal and myogenic differentiation. May play an essential role in postimplantation development, probably in some aspect of cell specification and/or differentiation. May be involved in mesoderm development, somite formation and neurogenesis. May enhance HIF1A function by sequestering HIF1AN away from HIF1A. Required for the THBS4 function in regulating protective astrogenesis from the subventricular zone (SVZ) niche after injury. Involved in determination of left/right symmetry by modulating the balance between motile and immotile (sensory) cilia at the left-right organiser (LRO).
Functions as a receptor for membrane-bound ligands Jagged-1 (JAG1), Jagged-2 (JAG2) and Delta-1 (DLL1) to regulate cell-fate determination (By similarity). Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus (By similarity). Affects the implementation of differentiation, proliferation and apoptotic programs (By similarity). Involved in angiogenesis; negatively regulates endothelial cell proliferation and migration and angiogenic sprouting (By similarity). Involved in the maturation of both CD4(+) and CD8(+) cells in the thymus (By similarity). Important for follicular differentiation and possibly cell fate selection within the follicle (By similarity). During cerebellar development, functions as a receptor for neuronal DNER and is involved in the differentiation of Bergmann glia (PubMed:11182080). Represses neuronal and myogenic differentiation (By similarity). May play an essential role in postimplantation development, probably in some aspect of cell specification and/or differentiation (By similarity). May be involved in mesoderm development, somite formation and neurogenesis (By similarity). May enhance HIF1A function by sequestering HIF1AN away from HIF1A (By similarity). Required for the THBS4 function in regulating protective astrogenesis from the subventricular zone (SVZ) niche after injury (By similarity). Involved in determination of left/right symmetry by modulating the balance between motile and immotile (sensory) cilia at the left-right organiser (LRO) (By similarity).
Functions as a receptor for membrane-bound ligands Jagged-1 (JAG1), Jagged-2 (JAG2) and Delta-1 (DLL1) to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs. Involved in angiogenesis; negatively regulates endothelial cell proliferation and migration and angiogenic sprouting. Involved in the maturation of both CD4(+) and CD8(+) cells in the thymus. Important for follicular differentiation and possibly cell fate selection within the follicle. During cerebellar development, functions as a receptor for neuronal DNER and is involved in the differentiation of Bergmann glia. Represses neuronal and myogenic differentiation. May play an essential role in postimplantation development, probably in some aspect of cell specification and/or differentiation. May be involved in mesoderm development, somite formation and neurogenesis. May enhance HIF1A function by sequestering HIF1AN away from HIF1A (By similarity). Required for the THBS4 function in regulating protective astrogenesis from the subventricular zone (SVZ) niche after injury. Involved in determination of left/right symmetry by modulating the balance between motile and immotile (sensory) cilia at the left-right organiser (LRO) (By similarity).
Functions as a receptor for membrane-bound ligands Jagged-1 (JAG1), Jagged-2 (JAG2) and Delta-1 (DLL1) to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs. Involved in angiogenesis; negatively regulates endothelial cell proliferation and migration and angiogenic sprouting. Involved in the maturation of both CD4(+) and CD8(+) cells in the thymus. Important for follicular differentiation and possibly cell fate selection within the follicle. During cerebellar development, functions as a receptor for neuronal DNER and is involved in the differentiation of Bergmann glia. Represses neuronal and myogenic differentiation. May play an essential role in postimplantation development, probably in some aspect of cell specification and/or differentiation. May be involved in mesoderm development, somite formation and neurogenesis (By similarity). Involved in determination of left/right symmetry by modulating the balance between motile and immotile (sensory) cilia at the left-right organiser (LRO).
Functions as a receptor for membrane-bound ligands Jagged1, Jagged2 and Delta1 to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs. May regulate branching morphogenesis in the developing vascular system (By similarity).
Functions as a receptor for membrane-bound ligands Jagged1, Jagged2 and Delta1 to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs (By similarity). May regulate branching morphogenesis in the developing vascular system.
Functions as a receptor for membrane-bound ligands Jagged-1 (JAG1), Jagged-2 (JAG2) and Delta-1 (DLL1) to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs. Involved in angiogenesis; negatively regulates endothelial cell proliferation and migration and angiogenic sprouting. Involved in the maturation of both CD4(+) and CD8(+) cells in the thymus. Important for follicular differentiation and possibly cell fate selection within the follicle. During cerebellar development, functions as a receptor for neuronal DNER and is involved in the differentiation of Bergmann glia. Represses neuronal and myogenic differentiation. May play an essential role in postimplantation development, probably in some aspect of cell specification and/or differentiation. May be involved in mesoderm development, somite formation and neurogenesis. Involved in determination of left/right symmetry by modulating the balance between motile and immotile (sensory) cilia at the left-right organiser (LRO) (By similarity).
Functions as a receptor for membrane-bound ligands Jagged-1 (JAG1), Jagged-2 (JAG2) and Delta-1 (DLL1) to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus (PubMed:21378985, PubMed:21378989). Affects the implementation of differentiation, proliferation and apoptotic programs (By similarity). Involved in bone remodeling and homeostasis. In collaboration with RELA/p65 enhances NFATc1 promoter activity and positively regulates RANKL-induced osteoclast differentiation (PubMed:29149593). Positively regulates self-renewal of liver cancer cells (PubMed:25985737).
Involved in several cell fate decisions that require cell-cell interactions. It is possible that lin-12 encodes a membrane-bound receptor for a signal that enables expression of the ventral uterine precursor cell fate. Activity in cell fate decisions and tumorigenesis is negatively regulated by sel-10.
Functions as a receptor for membrane-bound ligands Jagged-1 (JAG1), Jagged-2 (JAG2) and Delta-1 (DLL1) to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs. Involved in angiogenesis; negatively regulates endothelial cell proliferation and migration and angiogenic sprouting. Involved in the maturation of both CD4(+) and CD8(+) cells in the thymus. Important for follicular differentiation and possibly cell fate selection within the follicle. During cerebellar development, functions as a receptor for neuronal DNER and is involved in the differentiation of Bergmann glia. Represses neuronal and myogenic differentiation. May play an essential role in postimplantation development, probably in some aspect of cell specification and/or differentiation. May be involved in mesoderm development, somite formation and neurogenesis (By similarity). Involved in determination of left/right symmetry by modulating the balance between motile and immotile (sensory) cilia at the left-right organiser (LRO) (By similarity).
Functions as a receptor for membrane-bound ligands Jagged1, Jagged2 and Delta1 to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs (By similarity). May play a role during CNS development.
Functions as a receptor for membrane-bound ligands Jagged-1 (JAG1), Jagged-2 (JAG2) and Delta-1 (DLL1) to regulate cell-fate determination (PubMed:10393120). Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus (PubMed:10393120, PubMed:18710934). Affects the implementation of differentiation, proliferation and apoptotic programs (PubMed:10393120, PubMed:18710934). May play an essential role in postimplantation development, probably in some aspect of cell specification and/or differentiation (By similarity). In collaboration with RELA/p65 enhances NFATc1 promoter activity and positively regulates RANKL-induced osteoclast differentiation (PubMed:18710934). Positively regulates self-renewal of liver cancer cells (By similarity).
Functions as a receptor for membrane-bound ligands Jagged-1 (JAG1), Jagged-2 (JAG2) and Delta-1 (DLL1) to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs (By similarity). Involved in bone remodeling and homeostasis. In collaboration with RELA/p65 enhances NFATc1 promoter activity and positively regulates RANKL-induced osteoclast differentiation. Positively regulates self-renewal of liver cancer cells (By similarity).
Required to maintain the integrity of photoreceptor cells (PubMed:27737822, PubMed:28378834, PubMed:30052645). Specifically required for normal morphology of the photoreceptor ciliary pocket, and might thus facilitate protein trafficking between the photoreceptor inner and outer segments via the transition zone (PubMed:27737822).
Functions as a receptor for membrane-bound ligands Jagged1, Jagged2 and Delta1 to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs (By similarity). Acts instructively to control the cell fate determination of CNS multipotent progenitor cells, resulting in astroglial induction and neuron/oligodendrocyte suppression.
Required to maintain the integrity of photoreceptor cells (PubMed:18836446). Specifically required for normal morphology of the photoreceptor ciliary pocket, and might thus facilitate protein trafficking between the photoreceptor inner and outer segments via the transition zone (By similarity).
Ligand for Notch receptors and involved in the mediation of Notch signaling (By similarity). Seems to be involved in cell-fate decisions.
Required to maintain the integrity of photoreceptor cells (By similarity). Specifically required for normal morphology of the photoreceptor ciliary pocket, and might thus facilitate protein trafficking between the photoreceptor inner and outer segments via the transition zone (By similarity).
Ligand for multiple Notch receptors and involved in the mediation of Notch signaling (By similarity). Seems to be involved in cell-fate decisions.
Functions as a receptor for membrane-bound ligands Jagged1, Jagged2 and Delta1 to regulate cell-fate determination (PubMed:15350543). Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs (By similarity).
Apical polarity protein that plays a central role during the epithelial-to-mesenchymal transition (EMT) at gastrulation, when newly specified mesodermal cells move inside the embryo. Acts by promoting cell ingression, the process by which cells leave the epithelial epiblast and move inside the embryo to form a new tissue layer. The anisotropic distribution of CRB2 and MYH10/myosin-IIB at cell edges define which cells will ingress: cells with high apical CRB2 are probably extruded from the epiblast by neighboring cells with high levels of apical MYH10/myosin-IIB. Also required for maintenance of the apical polarity complex during development of the cortex.
Ligand for multiple Notch receptors and involved in the mediation of Notch signaling (PubMed:18660822, PubMed:20437614). May be involved in cell-fate decisions during hematopoiesis (PubMed:9462510). Seems to be involved in early and late stages of mammalian cardiovascular development. Inhibits myoblast differentiation (By similarity). Enhances fibroblast growth factor-induced angiogenesis (in vitro).
Essential signaling protein which has a major role in many developmental processes (PubMed:3935325). Functions as a receptor for membrane-bound ligands Delta and Serrate to regulate cell-fate determination (PubMed:10935637, PubMed:15620650, PubMed:12909620, PubMed:18243100). Upon ligand activation, and releasing from the cell membrane, the Notch intracellular domain (NICD) forms a transcriptional activator complex with Su(H) (Suppressor of hairless) and activates genes of the E(spl) complex (PubMed:7671825). Regulates oogenesis, the differentiation of the ectoderm and the development of the central and peripheral nervous system, eye, wing disk, muscles and segmental appendages such as antennae and legs, through lateral inhibition or induction (PubMed:11719214, PubMed:12369105, PubMed:3935325). Regulates neuroblast self-renewal, identity and proliferation through the regulation of bHLH-O proteins; in larval brains, involved in the maintenance of type II neuroblast self-renewal and identity by suppressing erm expression together with pnt; might also regulate dpn expression through the activation of the transcriptional regulator Su(H) (PubMed:27151950, PubMed:28899667, PubMed:20152183, PubMed:18342578, PubMed:23056424, PubMed:21262215).
Ligand for multiple Notch receptors and involved in the mediation of Notch signaling. May be involved in cell-fate decisions during hematopoiesis. Seems to be involved in early and late stages of mammalian cardiovascular development. Inhibits myoblast differentiation (By similarity). May regulate fibroblast growth factor-induced angiogenesis.
Apical polarity protein that plays a central role during the epithelial-to-mesenchymal transition (EMT) at gastrulation, when newly specified mesodermal cells move inside the embryo (PubMed:26496195, PubMed:27870829). Acts by promoting cell ingression, the process by which cells leave the epithelial epiblast and move inside the embryo to form a new tissue layer (PubMed:27870829). The anisotropic distribution of CRB2 and MYH10/myosin-IIB at cell edges define which cells will ingress: cells with high apical CRB2 are probably extruded from the epiblast by neighboring cells with high levels of apical MYH10/myosin-IIB (PubMed:27870829). Also required for maintenance of the apical polarity complex during development of the cortex.
Putative Notch ligand involved in the mediation of Notch signaling. Involved in limb development (By similarity).
Involved in the specification of the cell fates of the blastomeres, ABa and APa (PubMed:8156602). Proper signaling by glp-1 induces ABa descendants to produce anterior pharyngeal cells, and APa descendants to adopt a different fate (PubMed:8156602). Contributes to the establishment of the dorsal-ventral axis in early embryos (PubMed:8156602). Regulates germ cell mitotic proliferation probably by regulating MAP kinase phosphatase lip-1 expression (PubMed:22278922, PubMed:16319922). Plays a negative role in lifespan (PubMed:24332851, PubMed:28853436).
Plays a central role in cell polarity establishment (PubMed:2344615, PubMed:12900452, PubMed:10102271, PubMed:11740560). Participates in the assembly, positioning and maintenance of adherens junctions via its interaction with the SAC complex (PubMed:11740560, PubMed:12900452, PubMed:10102271, PubMed:11076972). Controls the coalescence of the spots of zonula adherens (ZA) into a adhesive ring around the cells (PubMed:11740560). It may act as a signal (PubMed:2344615). Involved in morphogenesis of the photoreceptor rhabdomere, for positioning and growth of rhabdomere and AJ during the crucial period of photoreceptor extension along the proximodistal axis of the retina (PubMed:12900452). Component of the crb-galla-Xpd (CGX) complex which is essential for proper mitotic chromosome segregation in early embryos (PubMed:25065591). The CGX complex is also required for cell proliferation in developing wing disks (PubMed:25065591). In the CGX complex, acts with galla-1 or galla-2 to recruit Xpd and thus form the functional complex. Together with apn, plays a key role in trachea development at larval stages (PubMed:30645584).
Transmembrane ligand protein of NOTCH1, NOTCH2 and NOTCH3 receptors that binds the extracellular domain (ECD) of Notch receptor in a cis and trans fashion manner (PubMed:21985982, PubMed:10958687). Following transinteraction, ligand cells produce mechanical force that depends of a clathrin-mediated endocytosis, requiring ligand ubiquitination, EPN1 interaction, and actin polymerisation; these events promote Notch receptor extracellular domain (NECD) transendocytosis and triggers Notch signaling through induction of cleavage, hyperphosphorylation, and nuclear accumulation of the intracellular domain of Notch receptors (NICD) (PubMed:10958687, PubMed:18676613). Is required for embryonic development and maintenance of adult stem cells in many different tissues and immune systeme; the DLL1-induced Notch signaling is mediated through an intercellular communication that regulates cell lineage, cell specification, cell patterning and morphogenesis through effects on differentiation and proliferation (PubMed:17194759, PubMed:19562077, PubMed:18997111, PubMed:23695674, PubMed:16495313, PubMed:21238454, PubMed:22282195, PubMed:7671806, PubMed:17960184, PubMed:22529374, PubMed:19389377, PubMed:23699523, PubMed:19144989, PubMed:23688253, PubMed:23806616, PubMed:26114479, PubMed:22940113, PubMed:25220152, PubMed:20081190, PubMed:21572390, PubMed:22096075). Plays a role in brain development at different level, namely by regulating neuronal differentiation of neural precursor cells via cell-cell interaction, most likely through the lateral inhibitory system in an endogenous level dependent-manner (PubMed:7671806, PubMed:18997111). During neocortex development, Dll1-Notch signaling transmission is mediated by dynamic interactions between intermediate neurogenic progenitors and radial glia; the cell-cell interactions are mediated via dynamic and transient elongation processes, likely to reactivate/maintain Notch activity in neighboring progenitors, and coordinate progenitor cell division and differentiation across radial and zonal boundaries (PubMed:23699523). During cerebellar development, regulates Bergmann glial monolayer formation and its morphological maturation through a Notch signaling pathway (PubMed:23688253). At the retina and spinal cord level, regulates neurogenesis by preventing the premature differentiation of neural progenitors and also by maintaining progenitors in spinal cord through Notch signaling pathway (PubMed:19389377, PubMed:26114479). Also controls neurogenesis of the neural tube in a progenitor domain-specific fashion along the dorsoventral axis (PubMed:20081190). Maintains quiescence of neural stem cells and plays a role as a fate determinant that segregates asymmetrically to one daughter cell during neural stem cells mitosis, resulting in neuronal differentiation in Dll1-inheriting cell (PubMed:23695674). Plays a role in immune systeme development, namely the development of all T-cells and marginal zone (MZ) B cells (PubMed:15146182, PubMed:19217325). Blocks the differentiation of progenitor cells into the B-cell lineage while promoting the emergence of a population of cells with the characteristics of a T-cell/NK-cell precursor (By similarity). Upon MMP14 cleavage, negatively regulates Notch signaling in haematopoietic progenitor cells to specifically maintain normal B-cell development in bone marrow (PubMed:21572390). Also plays a role during muscle development. During early development, inhibits myoblasts differentiation from the medial dermomyotomal lip and later regulates progenitor cell differentiation (PubMed:17194759). Directly modulates cell adhesion and basal lamina formation in satellite cells through Notch signaling. Maintains myogenic progenitors pool by suppressing differentiation through down-regulation of MYOD1 and is required for satellite cell homing and PAX7 expression (PubMed:22940113). During craniofacial and trunk myogenesis suppresses differentiation of cranial mesoderm-derived and somite-derived muscle via MYOD1 regulation but in cranial mesoderm-derived progenitors, is neither required for satellite cell homing nor for PAX7 expression (PubMed:25220152). Also plays a role during pancreatic cell development. During type B pancreatic cell development, may be involved in the initiation of proximodistal patterning in the early pancreatic epithelium (PubMed:22529374). Stimulates multipotent pancreatic progenitor cells proliferation and pancreatic growth by maintaining HES1 expression and PTF1A protein levels (PubMed:22096075). During fetal stages of development, is required to maintain arterial identity and the responsiveness of arterial endothelial cells for VEGFA through regulation of KDR activation and NRP1 expression (PubMed:19144989). Controls sprouting angiogenesis and subsequent vertical branch formation througth regulation on tip cell differentiation (PubMed:22282195). Negatively regulates goblet cell differentiation in intestine and controls secretory fat commitment through lateral inhibition in small intestine (PubMed:21238454, PubMed:21915337). Plays a role during inner ear development; negatively regulates auditory hair cell differentiation (PubMed:16495313). Plays a role during nephron development through Notch signaling pathway (PubMed:23806616). Regulates growth, blood pressure and energy homeostasis (PubMed:19562077).
Plays a role in photoreceptor morphogenesis in the retina. May maintain cell polarization and adhesion. Isoform 3 could play a role in epidermal tissue morphogenesis. May function in cell attachment for stratified epithelial organization.
Ligand for tyrosine-protein kinase receptors AXL, TYRO3 and MER whose signaling is implicated in cell growth and survival, cell adhesion and cell migration. GAS6/AXL signaling plays a role in various processes such as endothelial cell survival during acidification by preventing apoptosis, optimal cytokine signaling during human natural killer cell development, hepatic regeneration, gonadotropin-releasing hormone neuron survival and migration, platelet activation, or regulation of thrombotic responses.
(Microbial infection) Can bridge virus envelope phosphatidylserine to the TAM receptor tyrosine kinase Axl to mediate viral entry by apoptotic mimicry (PubMed:21501828). Plays a role in Dengue cell entry by apoptotic mimicry (PubMed:23084921). Plays a role in Vaccinia virus cell entry by apoptotic mimicry (PubMed:21501828). Plays a role in ebolavirus and marburgvirus cell entry by apoptotic mimicry (PubMed:17005688).
Transmembrane ligand protein of NOTCH1, NOTCH2 and NOTCH3 receptors that binds the extracellular domain (ECD) of Notch receptor in a cis and trans fashion manner (By similarity). Following transinteraction, ligand cells produce mechanical force that depends of a clathrin-mediated endocytosis, requiring ligand ubiquitination, EPN1 interaction, and actin polymerisation; these events promote Notch receptor extracellular domain (NECD) transendocytosis and triggers Notch signaling through induction of cleavage, hyperphosphorylation, and nuclear accumulation of the intracellular domain of Notch receptors (NICD) (PubMed:22658936). Is required for embryonic development and maintenance of adult stem cells in many different tissues and immune systeme; the DLL1-induced Notch signaling is mediated through an intercellular communication that regulates cell lineage, cell specification, cell patterning and morphogenesis through effects on differentiation and proliferation (By similarity). Plays a role in brain development at different level, namely by regulating neuronal differentiation of neural precursor cells via cell-cell interaction, most likely through the lateral inhibitory system in an endogenous level dependent-manner. During neocortex development, Dll1-Notch signaling transmission is mediated by dynamic interactions between intermediate neurogenic progenitors and radial glia; the cell-cell interactions are mediated via dynamic and transient elongation processes, likely to reactivate/maintain Notch activity in neighboring progenitors, and coordinate progenitor cell division and differentiation across radial and zonal boundaries. During cerebellar development, regulates Bergmann glial monolayer formation and its morphological maturation through a Notch signaling pathway. At the retina and spinal cord level, regulates neurogenesis by preventing the premature differentiation of neural progenitors and also by maintaining progenitors in spinal cord through Notch signaling pathway. Also controls neurogenesis of the neural tube in a progenitor domain-specific fashion along the dorsoventral axis. Maintains quiescence of neural stem cells and plays a role as a fate determinant that segregates asymmetrically to one daughter cell during neural stem cells mitosis, resulting in neuronal differentiation in Dll1-inheriting cell. Plays a role in immune systeme development, namely the development of all T-cells and marginal zone (MZ) B cells (By similarity). Blocks the differentiation of progenitor cells into the B-cell lineage while promoting the emergence of a population of cells with the characteristics of a T-cell/NK-cell precursor (By similarity). Also plays a role during muscle development. During early development, inhibits myoblasts differentiation from the medial dermomyotomal lip and later regulates progenitor cell differentiation. Directly modulates cell adhesion and basal lamina formation in satellite cells through Notch signaling. Maintains myogenic progenitors pool by suppressing differentiation through down-regulation of MYOD1 and is required for satellite cell homing and PAX7 expression. During craniofacial and trunk myogenesis suppresses differentiation of cranial mesoderm-derived and somite-derived muscle via MYOD1 regulation but in cranial mesoderm-derived progenitors, is neither required for satellite cell homing nor for PAX7 expression. Also plays a role during pancreatic cell development. During type B pancreatic cell development, may be involved in the initiation of proximodistal patterning in the early pancreatic epithelium. Stimulates multipotent pancreatic progenitor cells proliferation and pancreatic growth by maintaining HES1 expression and PTF1A protein levels. During fetal stages of development, is required to maintain arterial identity and the responsiveness of arterial endothelial cells for VEGFA through regulation of KDR activation and NRP1 expression. Controls sprouting angiogenesis and subsequent vertical branch formation througth regulation on tip cell differentiation. Negatively regulates goblet cell differentiation in intestine and controls secretory fat commitment through lateral inhibition in small intestine. Plays a role during inner ear development; negatively regulates auditory hair cell differentiation. Plays a role during nephron development through Notch signaling pathway. Regulates growth, blood pressure and energy homeostasis (By similarity).
Acts as a ligand for Notch receptors and is involved in primary neurogenesis. Can activate Notch receptors, thereby playing a key role in lateral inhibition, a process that prevents the immediate neighbors of each nascent neural cell from simultaneously embarking on neural differentiation. Required for boundary formation during segmentation of the hindbrain. Required for midline cell fate specification prior to germ layer formation; regulates specification of floorplate, notochord and hypochord. In inner ear, it prevents adjacent cells from adopting the same cell fate. Plays a role in angiogenesis.
May play a role in the cell attachment process.
Acts as a ligand for Notch receptors and is involved in primary neurogenesis and somitogenesis. Can activate Notch receptors, thereby playing a key role in lateral inhibition, a process that prevents the immediate neighbors of each nascent neural cell from simultaneously embarking on neural differentiation. Required in somite segmentation to keep the oscillations of neighboring presomitic mesoderm cells synchronized.
Acts as a ligand for Notch receptors and is involved in somitogenesis. Can activate Notch receptors. Required in somite segmentation to keep the oscillations of neighboring presomitic mesoderm cells synchronized.
Acts as a ligand for Notch (N) receptor. Essential for proper differentiation of ectoderm. Dl is required for the correct separation of neural and epidermal cell lineages. Fringe (fng) acts in the Golgi to determine the type of O-linked fucose on the EGF modules in N, altering the ability of N to bind with Delta (Dl). O-fut1 also has a role in modulating the interaction.
Acts as a scavenger receptor for acetylated low density lipoprotein. Binds to both Gram-positive and Gram-negative bacteria and may play a role in defense against bacterial infection. When inhibited in endothelial tube formation assays, there is a marked decrease in cell-cell interactions, suggesting a role in angiogenesis. Involved in the delivery of newly synthesized CHID1/SI-CLP from the biosynthetic compartment to the endosomal/lysosomal system.
Phosphatidylserine receptor that enhances the engulfment of apoptotic cells. Hyaluronan receptor that binds to and mediates endocytosis of hyaluronic acid (HA). Acts also, in different species, as a primary systemic scavenger receptor for heparin (Hep), chondroitin sulfate (CS), dermatan sulfate (DS), nonglycosaminoglycan (GAG), acetylated low-density lipoprotein (AcLDL), pro-collagen propeptides and advanced glycation end products (AGE). May serve to maintain tissue integrity by supporting extracellular matrix turnover or it may contribute to maintaining fluidity of bodily liquids by resorption of hyaluronan. Counter receptor which plays an important role in lymphocyte recruitment in the hepatic vasculature. Binds to both Gram-positive and Gram-negative bacteria and may play a role in defense against bacterial infection. The proteolytically processed short form also functions as an endocytosis receptor for heparin internalisation as well as HA and CS.
Adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions and is involved in various processes including cellular proliferation, migration, adhesion and attachment, inflammatory response to CNS injury, regulation of vascular inflammation and adaptive responses of the heart to pressure overload and in myocardial function and remodeling. Binds to structural extracellular matrix (ECM) proteins and modulates the ECM in response to tissue damage, contributing to cardioprotective and adaptive ECM remodeling. Plays a role in ER stress response, via its interaction with the activating transcription factor 6 alpha (ATF6) which produces adaptive ER stress response factors and protects myocardium from pressure overload. May contribute to spinal presynaptic hypersensitivity and neuropathic pain states after peripheral nerve injury. May play a role in regulating protective astrogenesis from the subventricular zone (SVZ) niche after injury in a NOTCH1-dependent manner (By similarity).
Cotransporter which plays a role in lipoprotein, vitamin and iron metabolism, by facilitating their uptake. Binds to ALB, MB, Kappa and lambda-light chains, TF, hemoglobin, GC, SCGB1A1, APOA1, high density lipoprotein, and the CBLIF-cobalamin complex. The binding of all ligands requires calcium. Serves as important transporter in several absorptive epithelia, including intestine, renal proximal tubules and embryonic yolk sac. Interaction with LRP2 mediates its trafficking throughout vesicles and facilitates the uptake of specific ligands like GC, hemoglobin, ALB, TF and SCGB1A1. Interaction with AMN controls its trafficking to the plasma membrane and facilitates endocytosis of ligands. May play an important role in the development of the peri-implantation embryo through internalization of APOA1 and cholesterol. Binds to LGALS3 at the maternal-fetal interface (By similarity).
Cotransporter which plays a role in lipoprotein, vitamin and iron metabolism, by facilitating their uptake. Binds to ALB, MB, Kappa and lambda-light chains, TF, hemoglobin, GC, SCGB1A1, APOA1, high density lipoprotein, and the CBLIF-cobalamin complex. The binding of all ligands requires calcium. Serves as important transporter in several absorptive epithelia, including intestine, renal proximal tubules and embryonic yolk sac. Interaction with LRP2 mediates its trafficking throughout vesicles and facilitates the uptake of specific ligands like GC, hemoglobin, ALB, TF and SCGB1A1. Interaction with AMN controls its trafficking to the plasma membrane and facilitates endocytosis of ligands. May play an important role in the development of the peri-implantation embryo through internalization of APOA1 and cholesterol. Binds to LGALS3 at the maternal-fetal interface.
Cotransporter which plays a role in lipoprotein, vitamin and iron metabolism, by facilitating their uptake.
Protease which specifically processes prolysyl oxidase and maybe also chordin. Required for the embryonic development. Predominant protease, which in the development, influences dorsal-ventral patterning and skeletogenesis. In embryos, inhibits the development of dorsoanterior structures and ventralizes activin-induced dorsal mesoderm in animal caps.
Protease which processes procollagen C-propeptides, such as chordin. Required for the embryonic development. Predominant protease, which in the development, influences dorsal-ventral patterning and skeletogenesis.
Protease which processes procollagen C-propeptides, such as chordin, probiglycan and prolysyl oxidase. Required for the embryonic development. Predominant protease, which in the development, influences dorsal-ventral patterning and skeletogenesis (By similarity).
Required for patterning ventral tissues of the tail. May increase bone morphogenetic protein (BMP) activity at the end of gastrulation by proteolytic cleavage of chordin and release of BMP from inactive complexes.
Protease which processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Required for the embryonic development, especially heart development. Predominant protease, which in the development, influences dorsal-ventral patterning and skeletogenesis.
Cleaves the C-terminal propeptides of procollagen I, II and III. Induces cartilage and bone formation. May participate in dorsoventral patterning during early development by cleaving chordin (CHRD) (By similarity). Responsible for the proteolytic activation of lysyl oxidase LOX.
May play roles in mucosal defense system and cellular immune defense. May play a role in liver regeneration. May be an important factor in fate decision and differentiation of transit-amplifying ductular (oval) cells within the hepatic lineage. May function as a binding protein in saliva for the regulation of taste sensation. May play a role as an opsonin receptor for SFTPD and SPAR in macrophage tissues throughout the body, including epithelial cells lining the gastrointestinal tract (By similarity). Required for terminal differentiation of columnar epithelial cells during early embryogenesis. Displays a broad calcium-dependent binding spectrum against both Gram-positive and Gram-negative bacteria, suggesting a role in defense against bacterial pathogens. Binds to a range of poly-sulfated and poly-phosphorylated ligands which may explain its broad bacterial-binding specificity. Inhibits cytoinvasion of S.enterica. Associates with the actin cytoskeleton and is involved in its remodeling during regulated exocytosis. Interacts with pancreatic zymogens in a pH-dependent manner and may act as a Golgi cargo receptor in the regulated secretory pathway of the pancreatic acinar cell.
Functions as a receptor for membrane-bound ligands Jagged-1 (JAG1), Jagged-2 (JAG2) and Delta-1 (DLL1) to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs. Involved in angiogenesis; negatively regulates endothelial cell proliferation and migration and angiogenic sprouting. Involved in the maturation of both CD4(+) and CD8(+) cells in the thymus. Important for follicular differentiation and possibly cell fate selection within the follicle. During cerebellar development, functions as a receptor for neuronal DNER and is involved in the differentiation of Bergmann glia. Represses neuronal and myogenic differentiation. May play an essential role in postimplantation development, probably in some aspect of cell specification and/or differentiation. May be involved in mesoderm development, somite formation and neurogenesis. May enhance HIF1A function by sequestering HIF1AN away from HIF1A. Required for the THBS4 function in regulating protective astrogenesis from the subventricular zone (SVZ) niche after injury. Involved in determination of left/right symmetry by modulating the balance between motile and immotile (sensory) cilia at the left-right organiser (LRO).
Functions as a receptor for membrane-bound ligands Jagged-1 (JAG1), Jagged-2 (JAG2) and Delta-1 (DLL1) to regulate cell-fate determination (By similarity). Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus (By similarity). Affects the implementation of differentiation, proliferation and apoptotic programs (By similarity). Involved in angiogenesis; negatively regulates endothelial cell proliferation and migration and angiogenic sprouting (By similarity). Involved in the maturation of both CD4(+) and CD8(+) cells in the thymus (By similarity). Important for follicular differentiation and possibly cell fate selection within the follicle (By similarity). During cerebellar development, functions as a receptor for neuronal DNER and is involved in the differentiation of Bergmann glia (PubMed:11182080). Represses neuronal and myogenic differentiation (By similarity). May play an essential role in postimplantation development, probably in some aspect of cell specification and/or differentiation (By similarity). May be involved in mesoderm development, somite formation and neurogenesis (By similarity). May enhance HIF1A function by sequestering HIF1AN away from HIF1A (By similarity). Required for the THBS4 function in regulating protective astrogenesis from the subventricular zone (SVZ) niche after injury (By similarity). Involved in determination of left/right symmetry by modulating the balance between motile and immotile (sensory) cilia at the left-right organiser (LRO) (By similarity).
Functions as a receptor for membrane-bound ligands Jagged-1 (JAG1), Jagged-2 (JAG2) and Delta-1 (DLL1) to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs. Involved in angiogenesis; negatively regulates endothelial cell proliferation and migration and angiogenic sprouting. Involved in the maturation of both CD4(+) and CD8(+) cells in the thymus. Important for follicular differentiation and possibly cell fate selection within the follicle. During cerebellar development, functions as a receptor for neuronal DNER and is involved in the differentiation of Bergmann glia. Represses neuronal and myogenic differentiation. May play an essential role in postimplantation development, probably in some aspect of cell specification and/or differentiation. May be involved in mesoderm development, somite formation and neurogenesis. May enhance HIF1A function by sequestering HIF1AN away from HIF1A (By similarity). Required for the THBS4 function in regulating protective astrogenesis from the subventricular zone (SVZ) niche after injury. Involved in determination of left/right symmetry by modulating the balance between motile and immotile (sensory) cilia at the left-right organiser (LRO) (By similarity).
Functions as a receptor for membrane-bound ligands Jagged-1 (JAG1), Jagged-2 (JAG2) and Delta-1 (DLL1) to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs. Involved in angiogenesis; negatively regulates endothelial cell proliferation and migration and angiogenic sprouting. Involved in the maturation of both CD4(+) and CD8(+) cells in the thymus. Important for follicular differentiation and possibly cell fate selection within the follicle. During cerebellar development, functions as a receptor for neuronal DNER and is involved in the differentiation of Bergmann glia. Represses neuronal and myogenic differentiation. May play an essential role in postimplantation development, probably in some aspect of cell specification and/or differentiation. May be involved in mesoderm development, somite formation and neurogenesis (By similarity). Involved in determination of left/right symmetry by modulating the balance between motile and immotile (sensory) cilia at the left-right organiser (LRO).
Functions as a receptor for membrane-bound ligands Jagged1, Jagged2 and Delta1 to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs. May regulate branching morphogenesis in the developing vascular system (By similarity).
Functions as a receptor for membrane-bound ligands Jagged1, Jagged2 and Delta1 to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs (By similarity). May regulate branching morphogenesis in the developing vascular system.
Functions as a receptor for membrane-bound ligands Jagged-1 (JAG1), Jagged-2 (JAG2) and Delta-1 (DLL1) to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs. Involved in angiogenesis; negatively regulates endothelial cell proliferation and migration and angiogenic sprouting. Involved in the maturation of both CD4(+) and CD8(+) cells in the thymus. Important for follicular differentiation and possibly cell fate selection within the follicle. During cerebellar development, functions as a receptor for neuronal DNER and is involved in the differentiation of Bergmann glia. Represses neuronal and myogenic differentiation. May play an essential role in postimplantation development, probably in some aspect of cell specification and/or differentiation. May be involved in mesoderm development, somite formation and neurogenesis. Involved in determination of left/right symmetry by modulating the balance between motile and immotile (sensory) cilia at the left-right organiser (LRO) (By similarity).
Functions as a receptor for membrane-bound ligands Jagged-1 (JAG1), Jagged-2 (JAG2) and Delta-1 (DLL1) to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus (PubMed:21378985, PubMed:21378989). Affects the implementation of differentiation, proliferation and apoptotic programs (By similarity). Involved in bone remodeling and homeostasis. In collaboration with RELA/p65 enhances NFATc1 promoter activity and positively regulates RANKL-induced osteoclast differentiation (PubMed:29149593). Positively regulates self-renewal of liver cancer cells (PubMed:25985737).
Involved in several cell fate decisions that require cell-cell interactions. It is possible that lin-12 encodes a membrane-bound receptor for a signal that enables expression of the ventral uterine precursor cell fate. Activity in cell fate decisions and tumorigenesis is negatively regulated by sel-10.
Functions as a receptor for membrane-bound ligands Jagged-1 (JAG1), Jagged-2 (JAG2) and Delta-1 (DLL1) to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs. Involved in angiogenesis; negatively regulates endothelial cell proliferation and migration and angiogenic sprouting. Involved in the maturation of both CD4(+) and CD8(+) cells in the thymus. Important for follicular differentiation and possibly cell fate selection within the follicle. During cerebellar development, functions as a receptor for neuronal DNER and is involved in the differentiation of Bergmann glia. Represses neuronal and myogenic differentiation. May play an essential role in postimplantation development, probably in some aspect of cell specification and/or differentiation. May be involved in mesoderm development, somite formation and neurogenesis (By similarity). Involved in determination of left/right symmetry by modulating the balance between motile and immotile (sensory) cilia at the left-right organiser (LRO) (By similarity).
Functions as a receptor for membrane-bound ligands Jagged1, Jagged2 and Delta1 to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs (By similarity). May play a role during CNS development.
Functions as a receptor for membrane-bound ligands Jagged-1 (JAG1), Jagged-2 (JAG2) and Delta-1 (DLL1) to regulate cell-fate determination (PubMed:10393120). Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus (PubMed:10393120, PubMed:18710934). Affects the implementation of differentiation, proliferation and apoptotic programs (PubMed:10393120, PubMed:18710934). May play an essential role in postimplantation development, probably in some aspect of cell specification and/or differentiation (By similarity). In collaboration with RELA/p65 enhances NFATc1 promoter activity and positively regulates RANKL-induced osteoclast differentiation (PubMed:18710934). Positively regulates self-renewal of liver cancer cells (By similarity).
Functions as a receptor for membrane-bound ligands Jagged-1 (JAG1), Jagged-2 (JAG2) and Delta-1 (DLL1) to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs (By similarity). Involved in bone remodeling and homeostasis. In collaboration with RELA/p65 enhances NFATc1 promoter activity and positively regulates RANKL-induced osteoclast differentiation. Positively regulates self-renewal of liver cancer cells (By similarity).
Required to maintain the integrity of photoreceptor cells (PubMed:27737822, PubMed:28378834, PubMed:30052645). Specifically required for normal morphology of the photoreceptor ciliary pocket, and might thus facilitate protein trafficking between the photoreceptor inner and outer segments via the transition zone (PubMed:27737822).
Functions as a receptor for membrane-bound ligands Jagged1, Jagged2 and Delta1 to regulate cell-fate determination. Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs (By similarity). Acts instructively to control the cell fate determination of CNS multipotent progenitor cells, resulting in astroglial induction and neuron/oligodendrocyte suppression.
Required to maintain the integrity of photoreceptor cells (PubMed:18836446). Specifically required for normal morphology of the photoreceptor ciliary pocket, and might thus facilitate protein trafficking between the photoreceptor inner and outer segments via the transition zone (By similarity).
Ligand for Notch receptors and involved in the mediation of Notch signaling (By similarity). Seems to be involved in cell-fate decisions.
Required to maintain the integrity of photoreceptor cells (By similarity). Specifically required for normal morphology of the photoreceptor ciliary pocket, and might thus facilitate protein trafficking between the photoreceptor inner and outer segments via the transition zone (By similarity).
Ligand for multiple Notch receptors and involved in the mediation of Notch signaling (By similarity). Seems to be involved in cell-fate decisions.
Functions as a receptor for membrane-bound ligands Jagged1, Jagged2 and Delta1 to regulate cell-fate determination (PubMed:15350543). Upon ligand activation through the released notch intracellular domain (NICD) it forms a transcriptional activator complex with RBPJ/RBPSUH and activates genes of the enhancer of split locus. Affects the implementation of differentiation, proliferation and apoptotic programs (By similarity).
Apical polarity protein that plays a central role during the epithelial-to-mesenchymal transition (EMT) at gastrulation, when newly specified mesodermal cells move inside the embryo. Acts by promoting cell ingression, the process by which cells leave the epithelial epiblast and move inside the embryo to form a new tissue layer. The anisotropic distribution of CRB2 and MYH10/myosin-IIB at cell edges define which cells will ingress: cells with high apical CRB2 are probably extruded from the epiblast by neighboring cells with high levels of apical MYH10/myosin-IIB. Also required for maintenance of the apical polarity complex during development of the cortex.
Ligand for multiple Notch receptors and involved in the mediation of Notch signaling (PubMed:18660822, PubMed:20437614). May be involved in cell-fate decisions during hematopoiesis (PubMed:9462510). Seems to be involved in early and late stages of mammalian cardiovascular development. Inhibits myoblast differentiation (By similarity). Enhances fibroblast growth factor-induced angiogenesis (in vitro).
Essential signaling protein which has a major role in many developmental processes (PubMed:3935325). Functions as a receptor for membrane-bound ligands Delta and Serrate to regulate cell-fate determination (PubMed:10935637, PubMed:15620650, PubMed:12909620, PubMed:18243100). Upon ligand activation, and releasing from the cell membrane, the Notch intracellular domain (NICD) forms a transcriptional activator complex with Su(H) (Suppressor of hairless) and activates genes of the E(spl) complex (PubMed:7671825). Regulates oogenesis, the differentiation of the ectoderm and the development of the central and peripheral nervous system, eye, wing disk, muscles and segmental appendages such as antennae and legs, through lateral inhibition or induction (PubMed:11719214, PubMed:12369105, PubMed:3935325). Regulates neuroblast self-renewal, identity and proliferation through the regulation of bHLH-O proteins; in larval brains, involved in the maintenance of type II neuroblast self-renewal and identity by suppressing erm expression together with pnt; might also regulate dpn expression through the activation of the transcriptional regulator Su(H) (PubMed:27151950, PubMed:28899667, PubMed:20152183, PubMed:18342578, PubMed:23056424, PubMed:21262215).
Ligand for multiple Notch receptors and involved in the mediation of Notch signaling. May be involved in cell-fate decisions during hematopoiesis. Seems to be involved in early and late stages of mammalian cardiovascular development. Inhibits myoblast differentiation (By similarity). May regulate fibroblast growth factor-induced angiogenesis.
Apical polarity protein that plays a central role during the epithelial-to-mesenchymal transition (EMT) at gastrulation, when newly specified mesodermal cells move inside the embryo (PubMed:26496195, PubMed:27870829). Acts by promoting cell ingression, the process by which cells leave the epithelial epiblast and move inside the embryo to form a new tissue layer (PubMed:27870829). The anisotropic distribution of CRB2 and MYH10/myosin-IIB at cell edges define which cells will ingress: cells with high apical CRB2 are probably extruded from the epiblast by neighboring cells with high levels of apical MYH10/myosin-IIB (PubMed:27870829). Also required for maintenance of the apical polarity complex during development of the cortex.
Putative Notch ligand involved in the mediation of Notch signaling. Involved in limb development (By similarity).
Involved in the specification of the cell fates of the blastomeres, ABa and APa (PubMed:8156602). Proper signaling by glp-1 induces ABa descendants to produce anterior pharyngeal cells, and APa descendants to adopt a different fate (PubMed:8156602). Contributes to the establishment of the dorsal-ventral axis in early embryos (PubMed:8156602). Regulates germ cell mitotic proliferation probably by regulating MAP kinase phosphatase lip-1 expression (PubMed:22278922, PubMed:16319922). Plays a negative role in lifespan (PubMed:24332851, PubMed:28853436).
Plays a central role in cell polarity establishment (PubMed:2344615, PubMed:12900452, PubMed:10102271, PubMed:11740560). Participates in the assembly, positioning and maintenance of adherens junctions via its interaction with the SAC complex (PubMed:11740560, PubMed:12900452, PubMed:10102271, PubMed:11076972). Controls the coalescence of the spots of zonula adherens (ZA) into a adhesive ring around the cells (PubMed:11740560). It may act as a signal (PubMed:2344615). Involved in morphogenesis of the photoreceptor rhabdomere, for positioning and growth of rhabdomere and AJ during the crucial period of photoreceptor extension along the proximodistal axis of the retina (PubMed:12900452). Component of the crb-galla-Xpd (CGX) complex which is essential for proper mitotic chromosome segregation in early embryos (PubMed:25065591). The CGX complex is also required for cell proliferation in developing wing disks (PubMed:25065591). In the CGX complex, acts with galla-1 or galla-2 to recruit Xpd and thus form the functional complex. Together with apn, plays a key role in trachea development at larval stages (PubMed:30645584).
Transmembrane ligand protein of NOTCH1, NOTCH2 and NOTCH3 receptors that binds the extracellular domain (ECD) of Notch receptor in a cis and trans fashion manner (PubMed:21985982, PubMed:10958687). Following transinteraction, ligand cells produce mechanical force that depends of a clathrin-mediated endocytosis, requiring ligand ubiquitination, EPN1 interaction, and actin polymerisation; these events promote Notch receptor extracellular domain (NECD) transendocytosis and triggers Notch signaling through induction of cleavage, hyperphosphorylation, and nuclear accumulation of the intracellular domain of Notch receptors (NICD) (PubMed:10958687, PubMed:18676613). Is required for embryonic development and maintenance of adult stem cells in many different tissues and immune systeme; the DLL1-induced Notch signaling is mediated through an intercellular communication that regulates cell lineage, cell specification, cell patterning and morphogenesis through effects on differentiation and proliferation (PubMed:17194759, PubMed:19562077, PubMed:18997111, PubMed:23695674, PubMed:16495313, PubMed:21238454, PubMed:22282195, PubMed:7671806, PubMed:17960184, PubMed:22529374, PubMed:19389377, PubMed:23699523, PubMed:19144989, PubMed:23688253, PubMed:23806616, PubMed:26114479, PubMed:22940113, PubMed:25220152, PubMed:20081190, PubMed:21572390, PubMed:22096075). Plays a role in brain development at different level, namely by regulating neuronal differentiation of neural precursor cells via cell-cell interaction, most likely through the lateral inhibitory system in an endogenous level dependent-manner (PubMed:7671806, PubMed:18997111). During neocortex development, Dll1-Notch signaling transmission is mediated by dynamic interactions between intermediate neurogenic progenitors and radial glia; the cell-cell interactions are mediated via dynamic and transient elongation processes, likely to reactivate/maintain Notch activity in neighboring progenitors, and coordinate progenitor cell division and differentiation across radial and zonal boundaries (PubMed:23699523). During cerebellar development, regulates Bergmann glial monolayer formation and its morphological maturation through a Notch signaling pathway (PubMed:23688253). At the retina and spinal cord level, regulates neurogenesis by preventing the premature differentiation of neural progenitors and also by maintaining progenitors in spinal cord through Notch signaling pathway (PubMed:19389377, PubMed:26114479). Also controls neurogenesis of the neural tube in a progenitor domain-specific fashion along the dorsoventral axis (PubMed:20081190). Maintains quiescence of neural stem cells and plays a role as a fate determinant that segregates asymmetrically to one daughter cell during neural stem cells mitosis, resulting in neuronal differentiation in Dll1-inheriting cell (PubMed:23695674). Plays a role in immune systeme development, namely the development of all T-cells and marginal zone (MZ) B cells (PubMed:15146182, PubMed:19217325). Blocks the differentiation of progenitor cells into the B-cell lineage while promoting the emergence of a population of cells with the characteristics of a T-cell/NK-cell precursor (By similarity). Upon MMP14 cleavage, negatively regulates Notch signaling in haematopoietic progenitor cells to specifically maintain normal B-cell development in bone marrow (PubMed:21572390). Also plays a role during muscle development. During early development, inhibits myoblasts differentiation from the medial dermomyotomal lip and later regulates progenitor cell differentiation (PubMed:17194759). Directly modulates cell adhesion and basal lamina formation in satellite cells through Notch signaling. Maintains myogenic progenitors pool by suppressing differentiation through down-regulation of MYOD1 and is required for satellite cell homing and PAX7 expression (PubMed:22940113). During craniofacial and trunk myogenesis suppresses differentiation of cranial mesoderm-derived and somite-derived muscle via MYOD1 regulation but in cranial mesoderm-derived progenitors, is neither required for satellite cell homing nor for PAX7 expression (PubMed:25220152). Also plays a role during pancreatic cell development. During type B pancreatic cell development, may be involved in the initiation of proximodistal patterning in the early pancreatic epithelium (PubMed:22529374). Stimulates multipotent pancreatic progenitor cells proliferation and pancreatic growth by maintaining HES1 expression and PTF1A protein levels (PubMed:22096075). During fetal stages of development, is required to maintain arterial identity and the responsiveness of arterial endothelial cells for VEGFA through regulation of KDR activation and NRP1 expression (PubMed:19144989). Controls sprouting angiogenesis and subsequent vertical branch formation througth regulation on tip cell differentiation (PubMed:22282195). Negatively regulates goblet cell differentiation in intestine and controls secretory fat commitment through lateral inhibition in small intestine (PubMed:21238454, PubMed:21915337). Plays a role during inner ear development; negatively regulates auditory hair cell differentiation (PubMed:16495313). Plays a role during nephron development through Notch signaling pathway (PubMed:23806616). Regulates growth, blood pressure and energy homeostasis (PubMed:19562077).
Plays a role in photoreceptor morphogenesis in the retina. May maintain cell polarization and adhesion. Isoform 3 could play a role in epidermal tissue morphogenesis. May function in cell attachment for stratified epithelial organization.
Ligand for tyrosine-protein kinase receptors AXL, TYRO3 and MER whose signaling is implicated in cell growth and survival, cell adhesion and cell migration. GAS6/AXL signaling plays a role in various processes such as endothelial cell survival during acidification by preventing apoptosis, optimal cytokine signaling during human natural killer cell development, hepatic regeneration, gonadotropin-releasing hormone neuron survival and migration, platelet activation, or regulation of thrombotic responses.
(Microbial infection) Can bridge virus envelope phosphatidylserine to the TAM receptor tyrosine kinase Axl to mediate viral entry by apoptotic mimicry (PubMed:21501828). Plays a role in Dengue cell entry by apoptotic mimicry (PubMed:23084921). Plays a role in Vaccinia virus cell entry by apoptotic mimicry (PubMed:21501828). Plays a role in ebolavirus and marburgvirus cell entry by apoptotic mimicry (PubMed:17005688).
Transmembrane ligand protein of NOTCH1, NOTCH2 and NOTCH3 receptors that binds the extracellular domain (ECD) of Notch receptor in a cis and trans fashion manner (By similarity). Following transinteraction, ligand cells produce mechanical force that depends of a clathrin-mediated endocytosis, requiring ligand ubiquitination, EPN1 interaction, and actin polymerisation; these events promote Notch receptor extracellular domain (NECD) transendocytosis and triggers Notch signaling through induction of cleavage, hyperphosphorylation, and nuclear accumulation of the intracellular domain of Notch receptors (NICD) (PubMed:22658936). Is required for embryonic development and maintenance of adult stem cells in many different tissues and immune systeme; the DLL1-induced Notch signaling is mediated through an intercellular communication that regulates cell lineage, cell specification, cell patterning and morphogenesis through effects on differentiation and proliferation (By similarity). Plays a role in brain development at different level, namely by regulating neuronal differentiation of neural precursor cells via cell-cell interaction, most likely through the lateral inhibitory system in an endogenous level dependent-manner. During neocortex development, Dll1-Notch signaling transmission is mediated by dynamic interactions between intermediate neurogenic progenitors and radial glia; the cell-cell interactions are mediated via dynamic and transient elongation processes, likely to reactivate/maintain Notch activity in neighboring progenitors, and coordinate progenitor cell division and differentiation across radial and zonal boundaries. During cerebellar development, regulates Bergmann glial monolayer formation and its morphological maturation through a Notch signaling pathway. At the retina and spinal cord level, regulates neurogenesis by preventing the premature differentiation of neural progenitors and also by maintaining progenitors in spinal cord through Notch signaling pathway. Also controls neurogenesis of the neural tube in a progenitor domain-specific fashion along the dorsoventral axis. Maintains quiescence of neural stem cells and plays a role as a fate determinant that segregates asymmetrically to one daughter cell during neural stem cells mitosis, resulting in neuronal differentiation in Dll1-inheriting cell. Plays a role in immune systeme development, namely the development of all T-cells and marginal zone (MZ) B cells (By similarity). Blocks the differentiation of progenitor cells into the B-cell lineage while promoting the emergence of a population of cells with the characteristics of a T-cell/NK-cell precursor (By similarity). Also plays a role during muscle development. During early development, inhibits myoblasts differentiation from the medial dermomyotomal lip and later regulates progenitor cell differentiation. Directly modulates cell adhesion and basal lamina formation in satellite cells through Notch signaling. Maintains myogenic progenitors pool by suppressing differentiation through down-regulation of MYOD1 and is required for satellite cell homing and PAX7 expression. During craniofacial and trunk myogenesis suppresses differentiation of cranial mesoderm-derived and somite-derived muscle via MYOD1 regulation but in cranial mesoderm-derived progenitors, is neither required for satellite cell homing nor for PAX7 expression. Also plays a role during pancreatic cell development. During type B pancreatic cell development, may be involved in the initiation of proximodistal patterning in the early pancreatic epithelium. Stimulates multipotent pancreatic progenitor cells proliferation and pancreatic growth by maintaining HES1 expression and PTF1A protein levels. During fetal stages of development, is required to maintain arterial identity and the responsiveness of arterial endothelial cells for VEGFA through regulation of KDR activation and NRP1 expression. Controls sprouting angiogenesis and subsequent vertical branch formation througth regulation on tip cell differentiation. Negatively regulates goblet cell differentiation in intestine and controls secretory fat commitment through lateral inhibition in small intestine. Plays a role during inner ear development; negatively regulates auditory hair cell differentiation. Plays a role during nephron development through Notch signaling pathway. Regulates growth, blood pressure and energy homeostasis (By similarity).
Acts as a ligand for Notch receptors and is involved in primary neurogenesis. Can activate Notch receptors, thereby playing a key role in lateral inhibition, a process that prevents the immediate neighbors of each nascent neural cell from simultaneously embarking on neural differentiation. Required for boundary formation during segmentation of the hindbrain. Required for midline cell fate specification prior to germ layer formation; regulates specification of floorplate, notochord and hypochord. In inner ear, it prevents adjacent cells from adopting the same cell fate. Plays a role in angiogenesis.
May play a role in the cell attachment process.
Acts as a ligand for Notch receptors and is involved in primary neurogenesis and somitogenesis. Can activate Notch receptors, thereby playing a key role in lateral inhibition, a process that prevents the immediate neighbors of each nascent neural cell from simultaneously embarking on neural differentiation. Required in somite segmentation to keep the oscillations of neighboring presomitic mesoderm cells synchronized.
Acts as a ligand for Notch receptors and is involved in somitogenesis. Can activate Notch receptors. Required in somite segmentation to keep the oscillations of neighboring presomitic mesoderm cells synchronized.
Acts as a ligand for Notch (N) receptor. Essential for proper differentiation of ectoderm. Dl is required for the correct separation of neural and epidermal cell lineages. Fringe (fng) acts in the Golgi to determine the type of O-linked fucose on the EGF modules in N, altering the ability of N to bind with Delta (Dl). O-fut1 also has a role in modulating the interaction.
Acts as a scavenger receptor for acetylated low density lipoprotein. Binds to both Gram-positive and Gram-negative bacteria and may play a role in defense against bacterial infection. When inhibited in endothelial tube formation assays, there is a marked decrease in cell-cell interactions, suggesting a role in angiogenesis. Involved in the delivery of newly synthesized CHID1/SI-CLP from the biosynthetic compartment to the endosomal/lysosomal system.
Phosphatidylserine receptor that enhances the engulfment of apoptotic cells. Hyaluronan receptor that binds to and mediates endocytosis of hyaluronic acid (HA). Acts also, in different species, as a primary systemic scavenger receptor for heparin (Hep), chondroitin sulfate (CS), dermatan sulfate (DS), nonglycosaminoglycan (GAG), acetylated low-density lipoprotein (AcLDL), pro-collagen propeptides and advanced glycation end products (AGE). May serve to maintain tissue integrity by supporting extracellular matrix turnover or it may contribute to maintaining fluidity of bodily liquids by resorption of hyaluronan. Counter receptor which plays an important role in lymphocyte recruitment in the hepatic vasculature. Binds to both Gram-positive and Gram-negative bacteria and may play a role in defense against bacterial infection. The proteolytically processed short form also functions as an endocytosis receptor for heparin internalisation as well as HA and CS.
Adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions and is involved in various processes including cellular proliferation, migration, adhesion and attachment, inflammatory response to CNS injury, regulation of vascular inflammation and adaptive responses of the heart to pressure overload and in myocardial function and remodeling. Binds to structural extracellular matrix (ECM) proteins and modulates the ECM in response to tissue damage, contributing to cardioprotective and adaptive ECM remodeling. Plays a role in ER stress response, via its interaction with the activating transcription factor 6 alpha (ATF6) which produces adaptive ER stress response factors and protects myocardium from pressure overload. May contribute to spinal presynaptic hypersensitivity and neuropathic pain states after peripheral nerve injury. May play a role in regulating protective astrogenesis from the subventricular zone (SVZ) niche after injury in a NOTCH1-dependent manner (By similarity).
Catalytic Activity
Cleavage of the C-terminal propeptide at Ala-|-Asp in type I and II procollagens and at Arg-|-Asp in type III.
Cofactor
Zn(2+)
Subunit
Interacts with LRP2 in a dual-receptor complex in a calcium-dependent manner. Component of the cubam complex composed of CUBN and AMN. The cubam complex can oligomerize and form cubam trimers. Found in a complex with PID1/PCLI1, LRP1 and CUBNI. Interacts with LRP1 and PID1/PCLI1 (By similarity).
Component of the cubam complex composed of CUBN and AMN (By similarity). The cubam complex can oligomerize and form cubam trimers. Interacts with LRP2 in a dual-receptor complex in a calcium-dependent manner. Found in a complex with PID1/PCLI1, LRP1 and CUBNI (By similarity). Interacts with LRP1 and PID1/PCLI1 (By similarity).
Interacts with LRP2 in a dual-receptor complex in a calcium-dependent manner (By similarity). Component of the cubam complex composed of CUBN and AMN. The cubam complex can oligomerize and form cubam trimers. Found in a complex with PID1/PCLI1, LRP1 and CUBNI (By similarity). Interacts with LRP1 and PID1/PCLI1 (By similarity).
Interacts with LRP2 in a dual-receptor complex in a calcium-dependent manner. Component of the cubam complex composed of CUBN and AMN. The cubam complex can oligomerize and form cubam trimers. Found in a complex with PID1/PCLI1, LRP1 and CUBNI. Interacts with LRP1 and PID1/PCLI1.
Interacts with POSTN, the interaction promotes deposition on the extracellular matrix.
Interacts with LGALS3. Binds SPAR in a calcium-dependent manner (By similarity). Binds SFTPD in a calcium-dependent manner.
Heterodimer of a C-terminal fragment N(TM) and an N-terminal fragment N(EC) which are probably linked by disulfide bonds. Interacts with DNER, DTX1, DTX2 and RBPJ/RBPSUH. Also interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH1. Notch 1 intracellular domain interacts with SNW1; the interaction involves multimerized NOTCH1 NICD and is implicated in a formation of an intermediate preactivation complex which associates with DNA-bound CBF-1/RBPJ. The activated membrane-bound form interacts with AAK1 which promotes NOTCH1 stabilization. Forms a trimeric complex with FBXW7 and SGK1. Interacts with HIF1AN. HIF1AN negatively regulates the function of notch intracellular domain (NICD), accelerating myogenic differentiation. Interacts (via NICD) with SNAI1 (via zinc fingers); the interaction induces SNAI1 degradation via MDM2-mediated ubiquitination and inhibits SNAI1-induced cell invasion. Interacts (via NICD) with MDM2A. Interacts (via NICD) with BCL6; the interaction decreases MAML1 recruitment by NOTCH1 NICD on target genes DNA and inhibits NOTCH1 transcractivation activity. Interacts with THBS4. Interacts (via the EGF-like repeat region) with CCN3 (via CTCK domain) (PubMed:12050162). Interacts (via EGF-like domains) with DLL4 (via N-terminal DSL and MNNL domains) (By similarity). Interacts with ZMIZ1. Interacts (via NICD domain) with MEGF10 (via the cytoplasmic domain) (PubMed:28498977). Interacts with DLL1 and JAG1 (PubMed:28089369). Interacts (via NICD domain) with PRAG1 (PubMed:25038227). Forms a complex with PRAG1, N1ICD and MAML1, in a MAML1-dependent manner (PubMed:25038227). Interacts (via transmembrane region) with PSEN1; the interaction is direct (By similarity).
Heterodimer of a C-terminal fragment N(TM) and an N-terminal fragment N(EC) which are probably linked by disulfide bonds. Interacts with DNER, DTX1, DTX2 and RBPJ/RBPSUH. Also interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH1. Notch 1 intracellular domain interacts with SNW1; the interaction involves multimerized NOTCH1 NICD and is implicated in a formation of an intermediate preactivation complex which associates with DNA-bound CBF-1/RBPJ. The activated membrane-bound form interacts with AAK1 which promotes NOTCH1 stabilization. Forms a trimeric complex with FBXW7 and SGK1. Interacts with HIF1AN. HIF1AN negatively regulates the function of notch intracellular domain (NICD), accelerating myogenic differentiation. Interacts (via NICD) with SNAI1 (via zinc fingers); the interaction induces SNAI1 degradation via MDM2-mediated ubiquitination and inhibits SNAI1-induced cell invasion. Interacts (via NICD) with MDM2A. Interacts (via NICD) with BCL6; the interaction decreases MAML1 recruitment by NOTCH1 NICD on target genes DNA and inhibits NOTCH1 transcractivation activity (By similarity). Interacts with THBS4 (By similarity). Interacts (via the EGF-like repeat region) with CCN3 (via CTCK domain) (By similarity). Interacts (via EGF-like domains) with DLL4 (via N-terminal DSL and MNNL domains) (PubMed:25700513). Interacts with ZMIZ1 (By similarity). Interacts (via NICD domain) with MEGF10 (via the cytoplasmic domain). Interacts with DLL1 and JAG1 (By similarity). Interacts (via NICD domain) with PRAG1 (By similarity). Forms a complex with PRAG1, N1ICD and MAML1, in a MAML1-dependent manner (By similarity). Interacts (via transmembrane region) with PSEN1; the interaction is direct (By similarity).
Heterodimer of a C-terminal fragment N(TM) and an N-terminal fragment N(EC) which are probably linked by disulfide bonds. Interacts with DNER, DTX1, DTX2 and RBPJ/RBPSUH. Also interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH1. Notch 1 intracellular domain interacts with SNW1; the interaction involves multimerized NOTCH1 NICD and is implicated in a formation of an intermediate preactivation complex which associates with DNA-bound CBF-1/RBPJ. The activated membrane-bound form interacts with AAK1 which promotes NOTCH1 stabilization. Forms a trimeric complex with FBXW7 and SGK1. Interacts with HIF1AN. HIF1AN negatively regulates the function of notch intracellular domain (NICD), accelerating myogenic differentiation. Interacts (via NICD) with SNAI1 (via zinc fingers); the interaction induces SNAI1 degradation via MDM2-mediated ubiquitination and inhibits SNAI1-induced cell invasion. Interacts (via NICD) with MDM2A. Interacts (via NICD) with BCL6; the interaction decreases MAML1 recruitment by NOTCH1 NICD on target genes DNA and inhibits NOTCH1 transcractivation activity (By similarity). Interacts with THBS4 (By similarity). Interacts (via the EGF-like repeat region) with CCN3 (via CTCK domain). Interacts (via EGF-like domains) with DLL4 (via N-terminal DSL and MNNL domains). Interacts with ZMIZ1. Interacts (via NICD domain) with MEGF10 (via the cytoplasmic domain). Interacts with DLL1 and JAG1 (By similarity). Interacts (via NICD domain) with PRAG1 (By similarity). Forms a complex with PRAG1, N1ICD and MAML1, in a MAML1-dependent manner (By similarity). Interacts (via transmembrane region) with PSEN1; the interaction is direct (By similarity).
Heterodimer of a C-terminal fragment N(TM) and an N-terminal fragment N(EC) which are probably linked by disulfide bonds. Interacts with DNER, DTX1, DTX2 and RBPJ/RBPSUH. Also interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH1 (PubMed:11101851, PubMed:12370315). The NOTCH1 intracellular domain interacts with SNW1; the interaction involves multimerized NOTCH1 NICD and is implicated in a formation of an intermediate preactivation complex which associates with DNA-bound CBF-1/RBPJ (PubMed:10713164). The activated membrane-bound form interacts with AAK1 which promotes NOTCH1 stabilization. Forms a trimeric complex with FBXW7 and SGK1. Interacts with HIF1AN. HIF1AN negatively regulates the function of notch intracellular domain (NICD), accelerating myogenic differentiation (PubMed:17573339). Interacts (via NICD) with SNAI1 (via zinc fingers); the interaction induces SNAI1 degradation via MDM2-mediated ubiquitination and inhibits SNAI1-induced cell invasion. Interacts (via NICD) with MDM2A. Interacts (via NICD) with BCL6; the interaction decreases MAML1 recruitment by NOTCH1 NICD on target genes DNA and inhibits NOTCH1 transcractivation activity. Interacts with THBS4 (By similarity). Interacts (via the EGF-like repeat region) with CCN3 (via CTCK domain) (PubMed:12050162). Interacts (via EGF-like domains) with DLL4 (via N-terminal DSL and MNNL domains) (By similarity). Interacts with ZMIZ1. Interacts (via NICD domain) with MEGF10 (via the cytoplasmic domain). Interacts with DLL1 and JAG1 (By similarity). Interacts (via NICD domain) with PRAG1 (By similarity). Forms a complex with PRAG1, N1ICD and MAML1, in a MAML1-dependent manner (By similarity). Interacts (via transmembrane region) with PSEN1; the interaction is direct (PubMed:30598546).
Heterodimer of a C-terminal fragment N(TM) and a N-terminal fragment N(EC) which are probably linked by disulfide bonds (By similarity). Interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH4.
Heterodimer of a C-terminal fragment N(TM) and a N-terminal fragment N(EC) which are probably linked by disulfide bonds. Interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH4.
Forms a ternary complex with nrarp and rbpj/suh.
Heterodimer of a C-terminal fragment N(TM) and an N-terminal fragment N(EC) which are probably linked by disulfide bonds (By similarity). Interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH2. Interacts with RELA/p65 (By similarity). Interacts with HIF1AN. Interacts (via ANK repeats) with TCIM, the interaction inhibits the nuclear translocation of NOTCH2 N2ICD (PubMed:25985737). Interacts with CUL1, RBX1, SKP1 and FBXW7 that are SCF(FBXW7) E3 ubiquitin-protein ligase complex components (PubMed:29149593). Interacts with MINAR1; this interaction increases MINAR1 stability and function (PubMed:29329397). Interacts with NOTCH2NL (NOTCH2NLA, NOTCH2NLB and/or NOTCH2NLC); leading to enhance Notch signaling pathway in a non-cell-autonomous manner (PubMed:29856954). Interacts with MDK; this interaction mediates a nuclear accumulation of NOTCH2 and therefore activation of NOTCH2 signaling leading to interaction between HES1 and STAT3 (PubMed:18469519).
Interacts with sel-10.
Interacts with PSMA1 (By similarity). Heterodimer of a C-terminal fragment N(TM) and a N-terminal fragment N(EC) which are probably linked by disulfide bonds. Interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH3. Interacts with HIF1AN.
Heterodimer of a C-terminal fragment N(TM) and an N-terminal fragment N(EC) which are probably linked by disulfide bonds. Interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH2. Interacts with RELA/p65. Interacts with HIF1AN. Interacts (via ANK repeats) with TCIM, the interaction inhibits the nuclear translocation of NOTCH2 N2ICD (By similarity). Interacts with CUL1, RBX1, SKP1 and FBXW7 that are SCF(FBXW7) E3 ubiquitin-protein ligase complex components. Interacts with MINAR1; this interaction increases MINAR1 stability and function (By similarity). Interacts with MDK; this interaction mediates a nuclear accumulation of NOTCH2 and therefore activation of NOTCH2 signaling leading to interaction between HES1 and STAT3 (By similarity).
Heterodimer of a C-terminal fragment N(TM) and an N-terminal fragment N(EC) which are probably linked by disulfide bonds (By similarity). Interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH2. Interacts with RELA/p65 (By similarity). Interacts with HIF1AN. Interacts (via ANK repeats) with TCIM, the interaction inhibits the nuclear translocation of NOTCH2 N2ICD (By similarity). Interacts with CUL1, RBX1, SKP1 and FBXW7 that are SCF(FBXW7) E3 ubiquitin-protein ligase complex components.Interacts with MINAR1; this interaction increases MINAR1 stability and function (By similarity). Interacts with MDK; this interaction mediates a nuclear accumulation of NOTCH2 and therefore activation of NOTCH2 signaling leading to interaction between HES1 and STAT3 (By similarity).
Heterodimer of a C-terminal fragment N(TM) and a N-terminal fragment N(EC) which are probably linked by disulfide bonds. Interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH3. Interacts with PSMA1 (By similarity). Interacts with HIF1AN (By similarity).
Homotetramer.
Heterodimer of a C-terminal fragment N(TM) and a N-terminal fragment N(EC) which are probably linked by disulfide bonds (By similarity). Interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH3. Interacts with PSMA1. Interacts with HIF1AN.
Interacts with NOTCH2 and NOTCH3 (By similarity). Interacts with NOTCH1 (in the presence of calcium ions) (PubMed:18660822).
Homomer. Interacts with Su(H) when activated. Interacts with Dx via its ANK repeats. Interacts with Dl via the EGF repeats and the Dl EGF repeats. Interacts with Nedd4 and Su(dx). Interacts with O-fut1; the interaction glycosylates N and transports N to early endosomes. Interacts with Akap200; the interaction stabilizes N/Notch protein levels by preventing Cbl-mediated ubiquitination and subsequent lysosomal degradation of N/Notch (PubMed:29309414).
Interacts with NOTCH1, NOTCH2 and NOTCH3.
Interacts with NOTCH1 (PubMed:28089369). Interacts with NOTCH2 and NOTCH3 (By similarity).
Component of the SAC complex, a complex composed of crb, Patj and sdt (PubMed:11740560, PubMed:10102271, PubMed:11076972). May interact with the par-6 complex, which is composed of par-6, baz and aPKC, via its interaction with Patj (PubMed:12900452, PubMed:10102271, PubMed:11076972). Interacts with other proteins with Patj and sdt via its short cytoplasmic tail (PubMed:11740560). Component of the CGX complex composed of crb, galla (galla-1 or galla-2) and Xpd (PubMed:25065591). Able to interact independently (via intracellular domain) with galla-1, galla-2 and Xpd (PubMed:25065591). Interacts with apn (PubMed:30645584).
Homodimer (PubMed:12794186). Interacts with TJP1 (PubMed:24715457). Interacts with MMP14; inhibits DLL1-induced Notch signaling (PubMed:21572390). Interacts with MAGI1 (via PDZ domain); forms a complex with CTNNB1 and CDH2 and promotes recruitment to the adherens junction and stabilization on the cell surface (PubMed:15908431). Interacts with PSEN1; undergoes a presenilin-dependent gamma-secretase cleavage that releases a Dll1-intracellular form (PubMed:12794186). Interacts with MFAP5 (PubMed:15788413). Interacts with MIB1 (PubMed:21985982). Interacts with NEURL1B; leads to ubiquitination (PubMed:17003037, PubMed:19723503). Interacts with NEURL1 (PubMed:19723503). Interacts with SYNJ2BP; enhances DLL1 protein stability, and promotes Notch signaling in endothelial cells (By similarity). Interacts with MAGI1, MAGI2, MAGI3 and MPDZ (By similarity). Interacts (via ubiquitin) with EPN1 (via IUM domain); binding with NOTCH1 attached to neighboring cell, promotes ligand ubiquitination and EPN1 interaction, leading to NECD transendocytosis and Notch signaling. Interacts with NOTCH1 (By similarity).
In photoreceptor cells, forms a complex with MPDZ, MPP4 and MPP5.
Heterodimer and heterotetramer with AXL.
Homodimer. Interacts with TJP1. Interacts with MAGI1 (via PDZ domain); forms a complex with CTNNB1 and CDH2 and promotes recruitment to the adherens junction and stabilization on the cell surface. Interacts with PSEN1; undergoes a presenilin-dependent gamma-secretase cleavage that releases a Dll1-intracellular form. Interacts with MFAP5. Interacts with MIB1. Interacts with NEURL1B; leads to ubiquitination. Interacts with NEURL1 (By similarity). Interacts with SYNJ2BP; enhances DLL1 protein stability, and promotes Notch signaling in endothelial cells. Interacts with MAGI1, MAGI2, MAGI3 and MPDZ (By similarity). Interacts (via ubiquitin) with EPN1 (via IUM domain); binding with NOTCH1 attached to neighboring cell, promotes ligand ubiquitination and EPN1 interaction, leading to NECD transendocytosis and Notch signaling (PubMed:22658936). Interacts with NOTCH1 (PubMed:28089369).
Interacts with mib.
Interacts with N via the EGF repeats and the N EGF repeats.
Interacts with CHID1.
Interacts with heparin, alpha-M/beta-2 integrin (ITGAM and ITGB2), and thymosin beta 4 (TMSB4X) (By similarity). Interacts with GULP1. Associates with clathrin and adapter protein AP-2; in liver sinusoidal endothelial cells (LSECs).
Homopentamer; disulfide-linked. Interacts with PTBP3. Interacts with NOTCH1 (By similarity). Interacts (via EGF-like 3; calcium-binding domain) with ATF6 and facilitates its processing, activation and nuclear translocation.
Component of the cubam complex composed of CUBN and AMN (By similarity). The cubam complex can oligomerize and form cubam trimers. Interacts with LRP2 in a dual-receptor complex in a calcium-dependent manner. Found in a complex with PID1/PCLI1, LRP1 and CUBNI (By similarity). Interacts with LRP1 and PID1/PCLI1 (By similarity).
Interacts with LRP2 in a dual-receptor complex in a calcium-dependent manner (By similarity). Component of the cubam complex composed of CUBN and AMN. The cubam complex can oligomerize and form cubam trimers. Found in a complex with PID1/PCLI1, LRP1 and CUBNI (By similarity). Interacts with LRP1 and PID1/PCLI1 (By similarity).
Interacts with LRP2 in a dual-receptor complex in a calcium-dependent manner. Component of the cubam complex composed of CUBN and AMN. The cubam complex can oligomerize and form cubam trimers. Found in a complex with PID1/PCLI1, LRP1 and CUBNI. Interacts with LRP1 and PID1/PCLI1.
Interacts with POSTN, the interaction promotes deposition on the extracellular matrix.
Interacts with LGALS3. Binds SPAR in a calcium-dependent manner (By similarity). Binds SFTPD in a calcium-dependent manner.
Heterodimer of a C-terminal fragment N(TM) and an N-terminal fragment N(EC) which are probably linked by disulfide bonds. Interacts with DNER, DTX1, DTX2 and RBPJ/RBPSUH. Also interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH1. Notch 1 intracellular domain interacts with SNW1; the interaction involves multimerized NOTCH1 NICD and is implicated in a formation of an intermediate preactivation complex which associates with DNA-bound CBF-1/RBPJ. The activated membrane-bound form interacts with AAK1 which promotes NOTCH1 stabilization. Forms a trimeric complex with FBXW7 and SGK1. Interacts with HIF1AN. HIF1AN negatively regulates the function of notch intracellular domain (NICD), accelerating myogenic differentiation. Interacts (via NICD) with SNAI1 (via zinc fingers); the interaction induces SNAI1 degradation via MDM2-mediated ubiquitination and inhibits SNAI1-induced cell invasion. Interacts (via NICD) with MDM2A. Interacts (via NICD) with BCL6; the interaction decreases MAML1 recruitment by NOTCH1 NICD on target genes DNA and inhibits NOTCH1 transcractivation activity. Interacts with THBS4. Interacts (via the EGF-like repeat region) with CCN3 (via CTCK domain) (PubMed:12050162). Interacts (via EGF-like domains) with DLL4 (via N-terminal DSL and MNNL domains) (By similarity). Interacts with ZMIZ1. Interacts (via NICD domain) with MEGF10 (via the cytoplasmic domain) (PubMed:28498977). Interacts with DLL1 and JAG1 (PubMed:28089369). Interacts (via NICD domain) with PRAG1 (PubMed:25038227). Forms a complex with PRAG1, N1ICD and MAML1, in a MAML1-dependent manner (PubMed:25038227). Interacts (via transmembrane region) with PSEN1; the interaction is direct (By similarity).
Heterodimer of a C-terminal fragment N(TM) and an N-terminal fragment N(EC) which are probably linked by disulfide bonds. Interacts with DNER, DTX1, DTX2 and RBPJ/RBPSUH. Also interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH1. Notch 1 intracellular domain interacts with SNW1; the interaction involves multimerized NOTCH1 NICD and is implicated in a formation of an intermediate preactivation complex which associates with DNA-bound CBF-1/RBPJ. The activated membrane-bound form interacts with AAK1 which promotes NOTCH1 stabilization. Forms a trimeric complex with FBXW7 and SGK1. Interacts with HIF1AN. HIF1AN negatively regulates the function of notch intracellular domain (NICD), accelerating myogenic differentiation. Interacts (via NICD) with SNAI1 (via zinc fingers); the interaction induces SNAI1 degradation via MDM2-mediated ubiquitination and inhibits SNAI1-induced cell invasion. Interacts (via NICD) with MDM2A. Interacts (via NICD) with BCL6; the interaction decreases MAML1 recruitment by NOTCH1 NICD on target genes DNA and inhibits NOTCH1 transcractivation activity (By similarity). Interacts with THBS4 (By similarity). Interacts (via the EGF-like repeat region) with CCN3 (via CTCK domain) (By similarity). Interacts (via EGF-like domains) with DLL4 (via N-terminal DSL and MNNL domains) (PubMed:25700513). Interacts with ZMIZ1 (By similarity). Interacts (via NICD domain) with MEGF10 (via the cytoplasmic domain). Interacts with DLL1 and JAG1 (By similarity). Interacts (via NICD domain) with PRAG1 (By similarity). Forms a complex with PRAG1, N1ICD and MAML1, in a MAML1-dependent manner (By similarity). Interacts (via transmembrane region) with PSEN1; the interaction is direct (By similarity).
Heterodimer of a C-terminal fragment N(TM) and an N-terminal fragment N(EC) which are probably linked by disulfide bonds. Interacts with DNER, DTX1, DTX2 and RBPJ/RBPSUH. Also interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH1. Notch 1 intracellular domain interacts with SNW1; the interaction involves multimerized NOTCH1 NICD and is implicated in a formation of an intermediate preactivation complex which associates with DNA-bound CBF-1/RBPJ. The activated membrane-bound form interacts with AAK1 which promotes NOTCH1 stabilization. Forms a trimeric complex with FBXW7 and SGK1. Interacts with HIF1AN. HIF1AN negatively regulates the function of notch intracellular domain (NICD), accelerating myogenic differentiation. Interacts (via NICD) with SNAI1 (via zinc fingers); the interaction induces SNAI1 degradation via MDM2-mediated ubiquitination and inhibits SNAI1-induced cell invasion. Interacts (via NICD) with MDM2A. Interacts (via NICD) with BCL6; the interaction decreases MAML1 recruitment by NOTCH1 NICD on target genes DNA and inhibits NOTCH1 transcractivation activity (By similarity). Interacts with THBS4 (By similarity). Interacts (via the EGF-like repeat region) with CCN3 (via CTCK domain). Interacts (via EGF-like domains) with DLL4 (via N-terminal DSL and MNNL domains). Interacts with ZMIZ1. Interacts (via NICD domain) with MEGF10 (via the cytoplasmic domain). Interacts with DLL1 and JAG1 (By similarity). Interacts (via NICD domain) with PRAG1 (By similarity). Forms a complex with PRAG1, N1ICD and MAML1, in a MAML1-dependent manner (By similarity). Interacts (via transmembrane region) with PSEN1; the interaction is direct (By similarity).
Heterodimer of a C-terminal fragment N(TM) and an N-terminal fragment N(EC) which are probably linked by disulfide bonds. Interacts with DNER, DTX1, DTX2 and RBPJ/RBPSUH. Also interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH1 (PubMed:11101851, PubMed:12370315). The NOTCH1 intracellular domain interacts with SNW1; the interaction involves multimerized NOTCH1 NICD and is implicated in a formation of an intermediate preactivation complex which associates with DNA-bound CBF-1/RBPJ (PubMed:10713164). The activated membrane-bound form interacts with AAK1 which promotes NOTCH1 stabilization. Forms a trimeric complex with FBXW7 and SGK1. Interacts with HIF1AN. HIF1AN negatively regulates the function of notch intracellular domain (NICD), accelerating myogenic differentiation (PubMed:17573339). Interacts (via NICD) with SNAI1 (via zinc fingers); the interaction induces SNAI1 degradation via MDM2-mediated ubiquitination and inhibits SNAI1-induced cell invasion. Interacts (via NICD) with MDM2A. Interacts (via NICD) with BCL6; the interaction decreases MAML1 recruitment by NOTCH1 NICD on target genes DNA and inhibits NOTCH1 transcractivation activity. Interacts with THBS4 (By similarity). Interacts (via the EGF-like repeat region) with CCN3 (via CTCK domain) (PubMed:12050162). Interacts (via EGF-like domains) with DLL4 (via N-terminal DSL and MNNL domains) (By similarity). Interacts with ZMIZ1. Interacts (via NICD domain) with MEGF10 (via the cytoplasmic domain). Interacts with DLL1 and JAG1 (By similarity). Interacts (via NICD domain) with PRAG1 (By similarity). Forms a complex with PRAG1, N1ICD and MAML1, in a MAML1-dependent manner (By similarity). Interacts (via transmembrane region) with PSEN1; the interaction is direct (PubMed:30598546).
Heterodimer of a C-terminal fragment N(TM) and a N-terminal fragment N(EC) which are probably linked by disulfide bonds (By similarity). Interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH4.
Heterodimer of a C-terminal fragment N(TM) and a N-terminal fragment N(EC) which are probably linked by disulfide bonds. Interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH4.
Forms a ternary complex with nrarp and rbpj/suh.
Heterodimer of a C-terminal fragment N(TM) and an N-terminal fragment N(EC) which are probably linked by disulfide bonds (By similarity). Interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH2. Interacts with RELA/p65 (By similarity). Interacts with HIF1AN. Interacts (via ANK repeats) with TCIM, the interaction inhibits the nuclear translocation of NOTCH2 N2ICD (PubMed:25985737). Interacts with CUL1, RBX1, SKP1 and FBXW7 that are SCF(FBXW7) E3 ubiquitin-protein ligase complex components (PubMed:29149593). Interacts with MINAR1; this interaction increases MINAR1 stability and function (PubMed:29329397). Interacts with NOTCH2NL (NOTCH2NLA, NOTCH2NLB and/or NOTCH2NLC); leading to enhance Notch signaling pathway in a non-cell-autonomous manner (PubMed:29856954). Interacts with MDK; this interaction mediates a nuclear accumulation of NOTCH2 and therefore activation of NOTCH2 signaling leading to interaction between HES1 and STAT3 (PubMed:18469519).
Interacts with sel-10.
Interacts with PSMA1 (By similarity). Heterodimer of a C-terminal fragment N(TM) and a N-terminal fragment N(EC) which are probably linked by disulfide bonds. Interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH3. Interacts with HIF1AN.
Heterodimer of a C-terminal fragment N(TM) and an N-terminal fragment N(EC) which are probably linked by disulfide bonds. Interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH2. Interacts with RELA/p65. Interacts with HIF1AN. Interacts (via ANK repeats) with TCIM, the interaction inhibits the nuclear translocation of NOTCH2 N2ICD (By similarity). Interacts with CUL1, RBX1, SKP1 and FBXW7 that are SCF(FBXW7) E3 ubiquitin-protein ligase complex components. Interacts with MINAR1; this interaction increases MINAR1 stability and function (By similarity). Interacts with MDK; this interaction mediates a nuclear accumulation of NOTCH2 and therefore activation of NOTCH2 signaling leading to interaction between HES1 and STAT3 (By similarity).
Heterodimer of a C-terminal fragment N(TM) and an N-terminal fragment N(EC) which are probably linked by disulfide bonds (By similarity). Interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH2. Interacts with RELA/p65 (By similarity). Interacts with HIF1AN. Interacts (via ANK repeats) with TCIM, the interaction inhibits the nuclear translocation of NOTCH2 N2ICD (By similarity). Interacts with CUL1, RBX1, SKP1 and FBXW7 that are SCF(FBXW7) E3 ubiquitin-protein ligase complex components.Interacts with MINAR1; this interaction increases MINAR1 stability and function (By similarity). Interacts with MDK; this interaction mediates a nuclear accumulation of NOTCH2 and therefore activation of NOTCH2 signaling leading to interaction between HES1 and STAT3 (By similarity).
Heterodimer of a C-terminal fragment N(TM) and a N-terminal fragment N(EC) which are probably linked by disulfide bonds. Interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH3. Interacts with PSMA1 (By similarity). Interacts with HIF1AN (By similarity).
Homotetramer.
Heterodimer of a C-terminal fragment N(TM) and a N-terminal fragment N(EC) which are probably linked by disulfide bonds (By similarity). Interacts with MAML1, MAML2 and MAML3 which act as transcriptional coactivators for NOTCH3. Interacts with PSMA1. Interacts with HIF1AN.
Interacts with NOTCH2 and NOTCH3 (By similarity). Interacts with NOTCH1 (in the presence of calcium ions) (PubMed:18660822).
Homomer. Interacts with Su(H) when activated. Interacts with Dx via its ANK repeats. Interacts with Dl via the EGF repeats and the Dl EGF repeats. Interacts with Nedd4 and Su(dx). Interacts with O-fut1; the interaction glycosylates N and transports N to early endosomes. Interacts with Akap200; the interaction stabilizes N/Notch protein levels by preventing Cbl-mediated ubiquitination and subsequent lysosomal degradation of N/Notch (PubMed:29309414).
Interacts with NOTCH1, NOTCH2 and NOTCH3.
Interacts with NOTCH1 (PubMed:28089369). Interacts with NOTCH2 and NOTCH3 (By similarity).
Component of the SAC complex, a complex composed of crb, Patj and sdt (PubMed:11740560, PubMed:10102271, PubMed:11076972). May interact with the par-6 complex, which is composed of par-6, baz and aPKC, via its interaction with Patj (PubMed:12900452, PubMed:10102271, PubMed:11076972). Interacts with other proteins with Patj and sdt via its short cytoplasmic tail (PubMed:11740560). Component of the CGX complex composed of crb, galla (galla-1 or galla-2) and Xpd (PubMed:25065591). Able to interact independently (via intracellular domain) with galla-1, galla-2 and Xpd (PubMed:25065591). Interacts with apn (PubMed:30645584).
Homodimer (PubMed:12794186). Interacts with TJP1 (PubMed:24715457). Interacts with MMP14; inhibits DLL1-induced Notch signaling (PubMed:21572390). Interacts with MAGI1 (via PDZ domain); forms a complex with CTNNB1 and CDH2 and promotes recruitment to the adherens junction and stabilization on the cell surface (PubMed:15908431). Interacts with PSEN1; undergoes a presenilin-dependent gamma-secretase cleavage that releases a Dll1-intracellular form (PubMed:12794186). Interacts with MFAP5 (PubMed:15788413). Interacts with MIB1 (PubMed:21985982). Interacts with NEURL1B; leads to ubiquitination (PubMed:17003037, PubMed:19723503). Interacts with NEURL1 (PubMed:19723503). Interacts with SYNJ2BP; enhances DLL1 protein stability, and promotes Notch signaling in endothelial cells (By similarity). Interacts with MAGI1, MAGI2, MAGI3 and MPDZ (By similarity). Interacts (via ubiquitin) with EPN1 (via IUM domain); binding with NOTCH1 attached to neighboring cell, promotes ligand ubiquitination and EPN1 interaction, leading to NECD transendocytosis and Notch signaling. Interacts with NOTCH1 (By similarity).
In photoreceptor cells, forms a complex with MPDZ, MPP4 and MPP5.
Heterodimer and heterotetramer with AXL.
Homodimer. Interacts with TJP1. Interacts with MAGI1 (via PDZ domain); forms a complex with CTNNB1 and CDH2 and promotes recruitment to the adherens junction and stabilization on the cell surface. Interacts with PSEN1; undergoes a presenilin-dependent gamma-secretase cleavage that releases a Dll1-intracellular form. Interacts with MFAP5. Interacts with MIB1. Interacts with NEURL1B; leads to ubiquitination. Interacts with NEURL1 (By similarity). Interacts with SYNJ2BP; enhances DLL1 protein stability, and promotes Notch signaling in endothelial cells. Interacts with MAGI1, MAGI2, MAGI3 and MPDZ (By similarity). Interacts (via ubiquitin) with EPN1 (via IUM domain); binding with NOTCH1 attached to neighboring cell, promotes ligand ubiquitination and EPN1 interaction, leading to NECD transendocytosis and Notch signaling (PubMed:22658936). Interacts with NOTCH1 (PubMed:28089369).
Interacts with mib.
Interacts with N via the EGF repeats and the N EGF repeats.
Interacts with CHID1.
Interacts with heparin, alpha-M/beta-2 integrin (ITGAM and ITGB2), and thymosin beta 4 (TMSB4X) (By similarity). Interacts with GULP1. Associates with clathrin and adapter protein AP-2; in liver sinusoidal endothelial cells (LSECs).
Homopentamer; disulfide-linked. Interacts with PTBP3. Interacts with NOTCH1 (By similarity). Interacts (via EGF-like 3; calcium-binding domain) with ATF6 and facilitates its processing, activation and nuclear translocation.
Miscellaneous
Mutations in TLD lead to a partial transformation of dorsal ectoderm into ventral ectoderm.
Although the protein is conserved in Drosophila, the gene encoding the orthologous protein is inactive in rodents.
When exogenously expressed, the C-terminal part is nuclear, phosphorylated, and acts as an insulin-responsive transcriptional activator.
Separation of neuroblasts from the ectoderm into the inner part of embryo is one of the first steps of CNS development in insects, this process is under control of the neurogenic genes.
Notch and Serrate may interact at the protein level, it is conceivable that the Serrate and Delta proteins may compete for binding with the Notch protein.
Although the protein is conserved in Drosophila, the gene encoding the orthologous protein is inactive in rodents.
When exogenously expressed, the C-terminal part is nuclear, phosphorylated, and acts as an insulin-responsive transcriptional activator.
Separation of neuroblasts from the ectoderm into the inner part of embryo is one of the first steps of CNS development in insects, this process is under control of the neurogenic genes.
Notch and Serrate may interact at the protein level, it is conceivable that the Serrate and Delta proteins may compete for binding with the Notch protein.
Similarity
Belongs to the DMBT1 family.
Belongs to the NOTCH family.
Belongs to the EYS family.
Belongs to the Crumbs protein family.
Belongs to the thrombospondin family.
Belongs to the NOTCH family.
Belongs to the EYS family.
Belongs to the Crumbs protein family.
Belongs to the thrombospondin family.
Keywords
Calcium
Cell membrane
Complete proteome
Disulfide bond
EGF-like domain
Glycoprotein
Membrane
Metal-binding
Protein transport
Reference proteome
Repeat
Signal
Transport
Cholesterol metabolism
Cleavage on pair of basic residues
Cobalamin
Cobalt
Direct protein sequencing
Endosome
Lipid metabolism
Lysosome
Phosphoprotein
Steroid metabolism
Sterol metabolism
Coated pit
3D-structure
Disease mutation
Endocytosis
Polymorphism
Receptor
Secreted
Developmental protein
Differentiation
Hydrolase
Metalloprotease
Protease
Zinc
Zymogen
Methylation
Alternative splicing
Atrial septal defect
Chondrogenesis
Cytokine
Extracellular matrix
Golgi apparatus
Growth factor
Osteogenesis
Osteogenesis imperfecta
Cytoplasmic vesicle
Transmembrane
Transmembrane helix
Activator
Angiogenesis
ANK repeat
Hydroxylation
Isopeptide bond
Notch signaling pathway
Nucleus
Transcription
Transcription regulation
Ubl conjugation
Triplet repeat expansion
Proto-oncogene
Cytoplasm
Cell projection
Cytoskeleton
Sensory transduction
Vision
Retinitis pigmentosa
Gastrulation
Deafness
Neurogenesis
Oogenesis
Sushi
Cell cycle
Cell division
Mitosis
Cell junction
Gamma-carboxyglutamic acid
Growth regulation
Host-virus interaction
Cell adhesion
Inflammatory response
Laminin EGF-like domain
Hyaluronic acid
Endoplasmic reticulum
Mitogen
Sarcoplasmic reticulum
Tissue remodeling
Unfolded protein response
Feature
chain Cubilin homolog
propeptide Removed in mature form
sequence variant In dbSNP:rs12259370.
splice variant In isoform 2.
propeptide Removed in mature form
sequence variant In dbSNP:rs12259370.
splice variant In isoform 2.
Uniprot
Q9W332.3
Q9TU53.1
O70244.2
Q9JLB4.3
O60494.5
Q20911.4
+ More
O57382.1 Q9WVM6.1 Q9Y6L7.1 O43897.1 Q8JI28.1 Q9DER7.1 O57460.1 Q62381.1 P98063.2 P13497.2 Q60997.2 P25723.2 Q01705.3 Q07008.3 G3I6Z6.2 P46531.4 A2RUV0.2 Q99466.2 P31695.3 P21783.3 Q04721.3 P14585.1 P46530.1 Q61982.1 O35516.2 Q9QW30.1 B8JI71.2 Q9R172.2 Q5T1H1.5 Q90Y54.1 Q5R6R1.3 Q90Y57.1 P10079.2 Q9UM47.2 Q5IJ48.2 A0A2K5V015.1 P78504.3 P07207.3 Q9QXX0.1 Q9QYE5.2 Q63722.2 Q80YA8.3 Q9Y219.3 P97607.1 P13508.1 Q8TER0.2 Q70E20.2 Q5ZQU0.2 P10040.3 P18168.3 Q61483.2 Q8VHS2.3 Q14393.3 P97677.1 Q6DI48.1 P0C6B8.1 Q8UWJ4.2 Q9IAT6.1 P10041.2 Q9NY15.3 Q4LDE5.3 Q8R4U0.1 P35443.2
O57382.1 Q9WVM6.1 Q9Y6L7.1 O43897.1 Q8JI28.1 Q9DER7.1 O57460.1 Q62381.1 P98063.2 P13497.2 Q60997.2 P25723.2 Q01705.3 Q07008.3 G3I6Z6.2 P46531.4 A2RUV0.2 Q99466.2 P31695.3 P21783.3 Q04721.3 P14585.1 P46530.1 Q61982.1 O35516.2 Q9QW30.1 B8JI71.2 Q9R172.2 Q5T1H1.5 Q90Y54.1 Q5R6R1.3 Q90Y57.1 P10079.2 Q9UM47.2 Q5IJ48.2 A0A2K5V015.1 P78504.3 P07207.3 Q9QXX0.1 Q9QYE5.2 Q63722.2 Q80YA8.3 Q9Y219.3 P97607.1 P13508.1 Q8TER0.2 Q70E20.2 Q5ZQU0.2 P10040.3 P18168.3 Q61483.2 Q8VHS2.3 Q14393.3 P97677.1 Q6DI48.1 P0C6B8.1 Q8UWJ4.2 Q9IAT6.1 P10041.2 Q9NY15.3 Q4LDE5.3 Q8R4U0.1 P35443.2
EC Number
3.4.24.-
3.4.24.19
3.4.24.19
Pubmed
10731132
12537572
12537569
23264686
10552972
9478979
+ More
9153271 9691015 10400683 10811843 11805171 12724130 15616221 16641100 20237569 19468303 11856751 10766831 11278724 14983511 15342463 19349973 21183079 9572993 15164054 10371504 11717447 11606717 14576052 17124247 10080186 10887099 16959974 21355061 21248752 23114252 9851916 12754521 17761667 9520331 10479448 15489334 11313359 24129315 10231032 10896944 18824173 18830233 12464431 10940628 9395394 10375503 8661043 16141072 10331975 8174772 20181949 8643539 3201241 9500680 7798260 14702039 11283002 12637569 14759258 22482805 22052668 25402547 8742698 10679193 7876332 7537458 8543783 9247472 9688648 11152281 12082154 12884308 15146979 15292166 15452149 15987769 17983803 18202109 1840509 7600963 8449489 7956822 12123574 12807718 1426644 8440332 1425352 9653148 10437788 8486742 18299578 9384671 10882062 10882063 11518718 11459941 11226752 12050162 15019995 15240571 15965470 18628966 21464124 21757702 23160044 23886940 23615612 25038227 28089369 28498977 30127001 15802643 17573339 1764995 15057822 11182080 1295745 11438922 25700513 21804562 10734111 15164053 1831692 10079256 9590294 10713164 11101851 12370315 16025100 18669648 20616313 22128911 21147854 21245387 24226769 25547411 26522984 12795601 15576031 16011479 16530044 28439555 30598546 25132448 20431018 9168133 9693032 14574404 1312643 9150355 8681805 14656967 10233982 11344305 2402639 11485984 16710414 1303260 9244302 17081983 18469519 19690332 20068231 21681853 21378989 21378985 23186163 25985737 29149593 29856954 29329397 17401372 16773578 21793104 21712856 23389697 3419531 7906398 3000611 9389650 8297791 7918097 8917536 10393120 7609614 18710934 19144319 21949356 11577080 22673903 23594743 27737822 28378834 30052645 18976725 18836446 12975309 20696082 27846257 21069908 20333770 26593283 2514273 3498216 2784773 2060714 15659374 8878478 15057824 17292860 25394726 9388399 10227618 10371548 10854111 11058919 11102981 10802807 11559313 11755616 11810186 12146805 12136071 12589106 12810003 15229130 15364702 15378071 15350543 15300988 16009764 15818833 18273901 23731542 24000151 15851977 25557779 25557780 9268641 9207788 9462510 10329626 11780052 8955070 9207787 10978356 21269460 18660822 19586525 9585603 10220506 10533065 11058898 11152664 11157803 11139247 11180599 12022040 12297837 12442286 12649809 12497640 15712272 16575836 23801938 20437614 3935325 3097517 10731137 3037327 2981631 2780284 8162848 7671825 10206646 10206647 10935637 11719214 11799064 12369105 12909620 15620649 15620650 17329366 18243100 18342578 18327897 20152183 21262215 23056424 27268051 27151950 28899667 29309414 14573873 10551863 10556292 9341252 9486542 9315665 7697721 22072575 23001562 26496195 27870829 26802325 10662552 8948600 2758466 1881436 8350921 8156602 9861048 16319922 22820175 22278922 24332851 28853436 15815621 15194686 12665856 15162516 2344615 3107986 10102271 11076972 11740560 12900452 17893096 25065591 30645584 2125287 1840519 15829515 15760269 7671806 21572390 12794186 10958687 15146182 15788413 15908431 16495313 17003037 17194759 18997111 17960184 18676613 19723503 19144989 19389377 19217325 19562077 20081190 21985982 21238454 21915337 22282195 22096075 22015720 22940113 22529374 23806616 23699523 23688253 23695674 24715457 25220152 24449764 26114479 11744384 14684155 11850625 12915475 15316081 8336730 15108283 15057823 7854420 7867073 9326368 8939948 9326369 12364394 18840707 21501828 23084921 17005688 26091039 8621659 16362042 12036964 22658936 9425133 9425132 10074451 10572043 15013799 15068793 15659486 17139625 9203139 12361969 11100729 12530964 10585570 16453806 3149249 15020426 2128477 11829752 12077138 9039502 12168954 16641997 16357325 19159218 24275569 16206243 17974005 12747765 11062057 22171320 12473645 14598175 15572036 17242355 18230608 8350346 7852353 19441079 22682248 23287452 23892609 22011848
9153271 9691015 10400683 10811843 11805171 12724130 15616221 16641100 20237569 19468303 11856751 10766831 11278724 14983511 15342463 19349973 21183079 9572993 15164054 10371504 11717447 11606717 14576052 17124247 10080186 10887099 16959974 21355061 21248752 23114252 9851916 12754521 17761667 9520331 10479448 15489334 11313359 24129315 10231032 10896944 18824173 18830233 12464431 10940628 9395394 10375503 8661043 16141072 10331975 8174772 20181949 8643539 3201241 9500680 7798260 14702039 11283002 12637569 14759258 22482805 22052668 25402547 8742698 10679193 7876332 7537458 8543783 9247472 9688648 11152281 12082154 12884308 15146979 15292166 15452149 15987769 17983803 18202109 1840509 7600963 8449489 7956822 12123574 12807718 1426644 8440332 1425352 9653148 10437788 8486742 18299578 9384671 10882062 10882063 11518718 11459941 11226752 12050162 15019995 15240571 15965470 18628966 21464124 21757702 23160044 23886940 23615612 25038227 28089369 28498977 30127001 15802643 17573339 1764995 15057822 11182080 1295745 11438922 25700513 21804562 10734111 15164053 1831692 10079256 9590294 10713164 11101851 12370315 16025100 18669648 20616313 22128911 21147854 21245387 24226769 25547411 26522984 12795601 15576031 16011479 16530044 28439555 30598546 25132448 20431018 9168133 9693032 14574404 1312643 9150355 8681805 14656967 10233982 11344305 2402639 11485984 16710414 1303260 9244302 17081983 18469519 19690332 20068231 21681853 21378989 21378985 23186163 25985737 29149593 29856954 29329397 17401372 16773578 21793104 21712856 23389697 3419531 7906398 3000611 9389650 8297791 7918097 8917536 10393120 7609614 18710934 19144319 21949356 11577080 22673903 23594743 27737822 28378834 30052645 18976725 18836446 12975309 20696082 27846257 21069908 20333770 26593283 2514273 3498216 2784773 2060714 15659374 8878478 15057824 17292860 25394726 9388399 10227618 10371548 10854111 11058919 11102981 10802807 11559313 11755616 11810186 12146805 12136071 12589106 12810003 15229130 15364702 15378071 15350543 15300988 16009764 15818833 18273901 23731542 24000151 15851977 25557779 25557780 9268641 9207788 9462510 10329626 11780052 8955070 9207787 10978356 21269460 18660822 19586525 9585603 10220506 10533065 11058898 11152664 11157803 11139247 11180599 12022040 12297837 12442286 12649809 12497640 15712272 16575836 23801938 20437614 3935325 3097517 10731137 3037327 2981631 2780284 8162848 7671825 10206646 10206647 10935637 11719214 11799064 12369105 12909620 15620649 15620650 17329366 18243100 18342578 18327897 20152183 21262215 23056424 27268051 27151950 28899667 29309414 14573873 10551863 10556292 9341252 9486542 9315665 7697721 22072575 23001562 26496195 27870829 26802325 10662552 8948600 2758466 1881436 8350921 8156602 9861048 16319922 22820175 22278922 24332851 28853436 15815621 15194686 12665856 15162516 2344615 3107986 10102271 11076972 11740560 12900452 17893096 25065591 30645584 2125287 1840519 15829515 15760269 7671806 21572390 12794186 10958687 15146182 15788413 15908431 16495313 17003037 17194759 18997111 17960184 18676613 19723503 19144989 19389377 19217325 19562077 20081190 21985982 21238454 21915337 22282195 22096075 22015720 22940113 22529374 23806616 23699523 23688253 23695674 24715457 25220152 24449764 26114479 11744384 14684155 11850625 12915475 15316081 8336730 15108283 15057823 7854420 7867073 9326368 8939948 9326369 12364394 18840707 21501828 23084921 17005688 26091039 8621659 16362042 12036964 22658936 9425133 9425132 10074451 10572043 15013799 15068793 15659486 17139625 9203139 12361969 11100729 12530964 10585570 16453806 3149249 15020426 2128477 11829752 12077138 9039502 12168954 16641997 16357325 19159218 24275569 16206243 17974005 12747765 11062057 22171320 12473645 14598175 15572036 17242355 18230608 8350346 7852353 19441079 22682248 23287452 23892609 22011848
EMBL
AE014298
AY084200
AAL89938.1
AF137068
AF022247
AL773538
+ More
AL928807 AF197159 AF034611 EF444970 AC067747 AL365215 AL596445 AL731551 Z74046 Z74473 Y09661 AF073526 BC132537 AF059516 AB023149 AL138765 AL136181 AL391136 BC013871 BC112341 BC112366 BC113577 U91963 AF282732 CH471056 BC016922 BC136429 BC136430 AF393242 AJ012462 AF027596 U34042 AK080919 AK139103 L24755 AC122268 BC066062 U50330 M22488 Y08723 Y08724 Y08725 L35278 L35279 AK291620 CH471080 BC136679 U37438 AB005909 BC049835 M76976 U04239 AE014297 Z11886 AF508809 AB100603 AL732541 CH466542 BC138441 BC138442 L02613 X68278 AK154528 AK157475 AJ238029 X82562 X57405 AABR06021907 AABR06021908 CH474001 JH001398 AF308602 AL592301 AL354671 M73980 AB209873 AAMC01043423 AAMC01043424 AAMC01043425 AAMC01043426 BC133053 D63395 D86566 U95299 U89335 AL662884 BX284686 BX284927 CR812478 CR933878 AB023961 AB024520 AB024578 M80456 U43691 AF030001 CT009767 AB016771 AB016772 AB016773 AB016774 M33874 AF308601 AF315356 AL359752 AL512503 AL596222 U77493 M12069 Z14092 X69088 X74760 D32210 AC154173 AC164091 CH466620 X68279 U31881 M93661 BX005106 BX323836 CR456624 CU570696 AF164486 FM209056 FJ416331 AY358133 AL050329 AL078597 AL109612 AL109922 AL132767 AL133322 AL137007 AL353153 AL353669 AL354719 AL354913 AL355357 AL356454 AL357375 AL365217 AL450319 AL450324 AL450394 AL589916 AL590546 AL590784 AL603767 BC133011 BC133013 AF229451 NDHI03003297 CR860424 AF229448 L08692 X17530 M17421 X17533 U97669 AF058900 AF058881 AF058882 AF058883 AF058884 AF058885 AF058886 AF058887 AF058888 AF058889 AF058890 AF058891 AF058892 AF058893 AF058894 AF058895 AF058896 AF058897 AF058898 AF058899 AC004257 AC004663 AY720432 AK123000 AK126775 AL445489 AL365504 DQ426866 AF003837 U73936 AF028593 U61276 AK302554 AL035456 BC126205 BC126207 U77720 M16152 M16153 M16149 M16150 M16151 K03508 M13689 K03507 AL035436 AL035395 M16025 M12175 AF171092 BC058675 AF038572 AC160929 AF010137 Y14495 L38483 AL805959 BC043114 BC062128 AF020201 AF003521 AF029778 AF029779 AF111170 Y14330 U70050 M25580 BX284603 Z29116 AC005237 AC093585 AC104809 AK074062 AK074075 AF439717 AF439718 BC027939 AY169783 AJ584850 BC145886 AK032805 AABR03068156 AABR03069106 AABR03069488 AABR03071665 AABR03072503 AF439715 AF439719 M33753 AY118509 X05144 M35759 X56811 X80903 AY497019 CH466630 BC057400 BC065063 AF406641 AY450552 AF492496 AK044345 AK044704 AC116810 AC138741 AL606536 CH466520 L13720 AY256843 AY256830 AY256831 AY256832 AY256833 AY256834 AY256835 AY256836 AY256837 AY256838 AY256839 AY256840 AY256841 AY256842 AK092028 AK122969 AK126533 AK290803 EF631974 BX072579 BC038984 AY170372 BK001240 U78889 AF030031 BC075742 AABR03040659 AABR03041327 AABR03041522 AABR03042206 AABR03044351 AABR03044745 AABR03045322 Y11760 AF426384 AF146429 X06289 Y00222 AY437145 AY437140 AY437141 AY437142 AY437143 AY437144 AY437151 AY437146 AY437147 AY437148 AY437149 AY437150 AY437157 AY437152 AY437153 AY437154 AY437155 AY437156 AY437163 AY437158 AY437159 AY437160 AY437161 AY437162 AY437169 AY437164 AY437165 AY437166 AY437167 AY437168 AY437175 AY437170 AY437171 AY437172 AY437173 AY437174 AY437181 AY437176 AY437177 AY437178 AY437179 AY437180 AY437187 AY437182 AY437183 AY437184 AY437185 AY437186 AY437193 AY437188 AY437189 AY437190 AY437191 AY437192 AY437199 AY437194 AY437195 AY437196 AY437197 AY437198 AY437205 AY437200 AY437201 AY437202 AY437203 AY437204 AY437211 AY437206 AY437207 AY437208 AY437209 AY437210 AY437217 AY437212 AY437213 AY437214 AY437215 AY437216 AY437223 AY437218 AY437219 AY437220 AY437221 AY437222 AY437229 AY437224 AY437225 AY437226 AY437227 AY437228 AY437235 AY437230 AY437231 AY437232 AY437233 AY437234 AY438104 AY438105 AY438106 AY438107 AY438108 AY438109 AY438110 AY438111 AY438112 AY438113 AY438114 AY438115 AY438116 AY438117 AY438118 AY438119 AY438120 AY438121 AY438122 AY438123 AY438124 AY438125 AY438126 AY438127 AY438128 AY438129 AY438130 AY438131 AY438132 AY438133 AY438134 AY438135 AY438136 AY438137 AY438138 AY438139 AY438140 AY438141 AY438147 AY438148 AY438149 AY438150 AY438151 AY438152 AY438153 AY438154 AY438155 AY438156 AY438157 AY438158 AY438159 AY438160 AY438161 AY438162 AY438163 AY438164 AY438165 AY438166 AY438167 AY438168 AY438169 AY438170 AY438171 AY438172 AY438173 AY438174 AY438175 AY438176 AY438177 AY438178 AY438179 AY438180 AY438181 AY438182 AY438183 AY438184 AY438185 AY438186 AY438187 AY438188 AY438189 AY438190 AY438191 AY438192 AY438193 AY438194 AY438195 AY438196 AY438197 AY438198 AY438199 AY438200 AY438201 AY438202 BK004004 BT003267 AY061269 X05140 AJ275213 AB052956 AB052957 D87433 AC006208 AC112215 BC150250 BAA13377.2 CAB61827.1 AJ619977 AY916667 AK023591 AK075235 AK027870 AL158158 AL354982 AL592463 BC030816 BX537918 BX538049 AF308289 AF364951 AK034522 AAL91684.2 Z19585 AK313587 AY566253 BC050456
AL928807 AF197159 AF034611 EF444970 AC067747 AL365215 AL596445 AL731551 Z74046 Z74473 Y09661 AF073526 BC132537 AF059516 AB023149 AL138765 AL136181 AL391136 BC013871 BC112341 BC112366 BC113577 U91963 AF282732 CH471056 BC016922 BC136429 BC136430 AF393242 AJ012462 AF027596 U34042 AK080919 AK139103 L24755 AC122268 BC066062 U50330 M22488 Y08723 Y08724 Y08725 L35278 L35279 AK291620 CH471080 BC136679 U37438 AB005909 BC049835 M76976 U04239 AE014297 Z11886 AF508809 AB100603 AL732541 CH466542 BC138441 BC138442 L02613 X68278 AK154528 AK157475 AJ238029 X82562 X57405 AABR06021907 AABR06021908 CH474001 JH001398 AF308602 AL592301 AL354671 M73980 AB209873 AAMC01043423 AAMC01043424 AAMC01043425 AAMC01043426 BC133053 D63395 D86566 U95299 U89335 AL662884 BX284686 BX284927 CR812478 CR933878 AB023961 AB024520 AB024578 M80456 U43691 AF030001 CT009767 AB016771 AB016772 AB016773 AB016774 M33874 AF308601 AF315356 AL359752 AL512503 AL596222 U77493 M12069 Z14092 X69088 X74760 D32210 AC154173 AC164091 CH466620 X68279 U31881 M93661 BX005106 BX323836 CR456624 CU570696 AF164486 FM209056 FJ416331 AY358133 AL050329 AL078597 AL109612 AL109922 AL132767 AL133322 AL137007 AL353153 AL353669 AL354719 AL354913 AL355357 AL356454 AL357375 AL365217 AL450319 AL450324 AL450394 AL589916 AL590546 AL590784 AL603767 BC133011 BC133013 AF229451 NDHI03003297 CR860424 AF229448 L08692 X17530 M17421 X17533 U97669 AF058900 AF058881 AF058882 AF058883 AF058884 AF058885 AF058886 AF058887 AF058888 AF058889 AF058890 AF058891 AF058892 AF058893 AF058894 AF058895 AF058896 AF058897 AF058898 AF058899 AC004257 AC004663 AY720432 AK123000 AK126775 AL445489 AL365504 DQ426866 AF003837 U73936 AF028593 U61276 AK302554 AL035456 BC126205 BC126207 U77720 M16152 M16153 M16149 M16150 M16151 K03508 M13689 K03507 AL035436 AL035395 M16025 M12175 AF171092 BC058675 AF038572 AC160929 AF010137 Y14495 L38483 AL805959 BC043114 BC062128 AF020201 AF003521 AF029778 AF029779 AF111170 Y14330 U70050 M25580 BX284603 Z29116 AC005237 AC093585 AC104809 AK074062 AK074075 AF439717 AF439718 BC027939 AY169783 AJ584850 BC145886 AK032805 AABR03068156 AABR03069106 AABR03069488 AABR03071665 AABR03072503 AF439715 AF439719 M33753 AY118509 X05144 M35759 X56811 X80903 AY497019 CH466630 BC057400 BC065063 AF406641 AY450552 AF492496 AK044345 AK044704 AC116810 AC138741 AL606536 CH466520 L13720 AY256843 AY256830 AY256831 AY256832 AY256833 AY256834 AY256835 AY256836 AY256837 AY256838 AY256839 AY256840 AY256841 AY256842 AK092028 AK122969 AK126533 AK290803 EF631974 BX072579 BC038984 AY170372 BK001240 U78889 AF030031 BC075742 AABR03040659 AABR03041327 AABR03041522 AABR03042206 AABR03044351 AABR03044745 AABR03045322 Y11760 AF426384 AF146429 X06289 Y00222 AY437145 AY437140 AY437141 AY437142 AY437143 AY437144 AY437151 AY437146 AY437147 AY437148 AY437149 AY437150 AY437157 AY437152 AY437153 AY437154 AY437155 AY437156 AY437163 AY437158 AY437159 AY437160 AY437161 AY437162 AY437169 AY437164 AY437165 AY437166 AY437167 AY437168 AY437175 AY437170 AY437171 AY437172 AY437173 AY437174 AY437181 AY437176 AY437177 AY437178 AY437179 AY437180 AY437187 AY437182 AY437183 AY437184 AY437185 AY437186 AY437193 AY437188 AY437189 AY437190 AY437191 AY437192 AY437199 AY437194 AY437195 AY437196 AY437197 AY437198 AY437205 AY437200 AY437201 AY437202 AY437203 AY437204 AY437211 AY437206 AY437207 AY437208 AY437209 AY437210 AY437217 AY437212 AY437213 AY437214 AY437215 AY437216 AY437223 AY437218 AY437219 AY437220 AY437221 AY437222 AY437229 AY437224 AY437225 AY437226 AY437227 AY437228 AY437235 AY437230 AY437231 AY437232 AY437233 AY437234 AY438104 AY438105 AY438106 AY438107 AY438108 AY438109 AY438110 AY438111 AY438112 AY438113 AY438114 AY438115 AY438116 AY438117 AY438118 AY438119 AY438120 AY438121 AY438122 AY438123 AY438124 AY438125 AY438126 AY438127 AY438128 AY438129 AY438130 AY438131 AY438132 AY438133 AY438134 AY438135 AY438136 AY438137 AY438138 AY438139 AY438140 AY438141 AY438147 AY438148 AY438149 AY438150 AY438151 AY438152 AY438153 AY438154 AY438155 AY438156 AY438157 AY438158 AY438159 AY438160 AY438161 AY438162 AY438163 AY438164 AY438165 AY438166 AY438167 AY438168 AY438169 AY438170 AY438171 AY438172 AY438173 AY438174 AY438175 AY438176 AY438177 AY438178 AY438179 AY438180 AY438181 AY438182 AY438183 AY438184 AY438185 AY438186 AY438187 AY438188 AY438189 AY438190 AY438191 AY438192 AY438193 AY438194 AY438195 AY438196 AY438197 AY438198 AY438199 AY438200 AY438201 AY438202 BK004004 BT003267 AY061269 X05140 AJ275213 AB052956 AB052957 D87433 AC006208 AC112215 BC150250 BAA13377.2 CAB61827.1 AJ619977 AY916667 AK023591 AK075235 AK027870 AL158158 AL354982 AL592463 BC030816 BX537918 BX538049 AF308289 AF364951 AK034522 AAL91684.2 Z19585 AK313587 AY566253 BC050456
Proteomes
PRIDE
Q9W332
Q9TU53
O70244
Q9JLB4
O60494
Q20911
+ More
O57382 Q9WVM6 Q9Y6L7 O43897 Q8JI28 Q9DER7 O57460 Q62381 P98063 P13497 Q60997 P25723 Q01705 Q07008 G3I6Z6 P46531 Q99466 P31695 P21783 Q04721 P14585 P46530 Q61982 O35516 Q9QW30 Q9R172 Q5T1H1 Q90Y54 Q5R6R1 Q90Y57 P10079 Q9UM47 Q5IJ48 P78504 P07207 Q9QXX0 Q9QYE5 Q63722 Q80YA8 Q9Y219 P97607 P13508 Q8TER0 Q70E20 Q5ZQU0 P10040 P18168 Q61483 Q8VHS2 Q14393 P97677 Q6DI48 P0C6B8 Q8UWJ4 Q9IAT6 P10041 Q9NY15 Q4LDE5 Q8R4U0 P35443
O57382 Q9WVM6 Q9Y6L7 O43897 Q8JI28 Q9DER7 O57460 Q62381 P98063 P13497 Q60997 P25723 Q01705 Q07008 G3I6Z6 P46531 Q99466 P31695 P21783 Q04721 P14585 P46530 Q61982 O35516 Q9QW30 Q9R172 Q5T1H1 Q90Y54 Q5R6R1 Q90Y57 P10079 Q9UM47 Q5IJ48 P78504 P07207 Q9QXX0 Q9QYE5 Q63722 Q80YA8 Q9Y219 P97607 P13508 Q8TER0 Q70E20 Q5ZQU0 P10040 P18168 Q61483 Q8VHS2 Q14393 P97677 Q6DI48 P0C6B8 Q8UWJ4 Q9IAT6 P10041 Q9NY15 Q4LDE5 Q8R4U0 P35443
Pfam
PF00008 EGF
+ More
PF00431 CUB
PF07645 EGF_CA
PF12661 hEGF
PF12947 EGF_3
PF01400 Astacin
PF00530 SRCR
PF00100 Zona_pellucida
PF00066 Notch
PF11936 DUF3454
PF12796 Ank_2
PF07684 NODP
PF06816 NOD
PF00023 Ank
PF02210 Laminin_G_2
PF07657 MNNL
PF01414 DSL
PF01382 Avidin
PF06119 NIDO
PF00041 fn3
PF00054 Laminin_G_1
PF12662 cEGF
PF00594 Gla
PF00092 VWA
PF00354 Pentaxin
PF02494 HYR
PF00084 Sushi
PF07699 Ephrin_rec_like
PF02469 Fasciclin
PF00193 Xlink
PF05735 TSP_C
PF02412 TSP_3
PF11598 COMP
PF00431 CUB
PF07645 EGF_CA
PF12661 hEGF
PF12947 EGF_3
PF01400 Astacin
PF00530 SRCR
PF00100 Zona_pellucida
PF00066 Notch
PF11936 DUF3454
PF12796 Ank_2
PF07684 NODP
PF06816 NOD
PF00023 Ank
PF02210 Laminin_G_2
PF07657 MNNL
PF01414 DSL
PF01382 Avidin
PF06119 NIDO
PF00041 fn3
PF00054 Laminin_G_1
PF12662 cEGF
PF00594 Gla
PF00092 VWA
PF00354 Pentaxin
PF02494 HYR
PF00084 Sushi
PF07699 Ephrin_rec_like
PF02469 Fasciclin
PF00193 Xlink
PF05735 TSP_C
PF02412 TSP_3
PF11598 COMP
Interpro
IPR009030
Growth_fac_rcpt_cys_sf
+ More
IPR001881 EGF-like_Ca-bd_dom
IPR018097 EGF_Ca-bd_CS
IPR000859 CUB_dom
IPR035914 Sperma_CUB_dom_sf
IPR000152 EGF-type_Asp/Asn_hydroxyl_site
IPR013032 EGF-like_CS
IPR000742 EGF-like_dom
IPR024731 EGF_dom
IPR034036 ZnMP_TLD/BMP1
IPR015446 BMP_1/tolloid-like
IPR001506 Peptidase_M12A
IPR024079 MetalloPept_cat_dom_sf
IPR006026 Peptidase_Metallo
IPR029837 BMP-1
IPR001507 ZP_dom
IPR017977 ZP_dom_CS
IPR036772 SRCR-like_dom_sf
IPR001190 SRCR
IPR017448 SRCR-like_dom
IPR036770 Ankyrin_rpt-contain_sf
IPR010660 Notch_NOD_dom
IPR022362 Notch_1
IPR035993 Notch-like_dom_sf
IPR011656 Notch_NODP_dom
IPR020683 Ankyrin_rpt-contain_dom
IPR008297 Notch
IPR000800 Notch_dom
IPR002110 Ankyrin_rpt
IPR024600 DUF3454_notch
IPR022355 Notch_4
IPR022336 Notch_2
IPR022331 Notch_3
IPR001791 Laminin_G
IPR013320 ConA-like_dom_sf
IPR026219 Jagged/Serrate
IPR001007 VWF_dom
IPR011651 Notch_ligand_N
IPR001774 DSL
IPR036896 Avidin-like_sf
IPR005468 Avidin/str
IPR005469 Avidin
IPR017889 Avidin-like_CS
IPR033108 Jag2
IPR036116 FN3_sf
IPR035976 Sushi/SCR/CCP_sf
IPR013783 Ig-like_fold
IPR003961 FN3_dom
IPR000436 Sushi_SCR_CCP_dom
IPR003886 NIDO_dom
IPR017857 Coagulation_fac-like_Gla_dom
IPR000294 GLA_domain
IPR026823 cEGF
IPR035972 GLA-like_dom_SF
IPR036465 vWFA_dom_sf
IPR002035 VWF_A
IPR001759 Pentraxin-related
IPR003410 HYR_dom
IPR011641 Tyr-kin_ephrin_A/B_rcpt-like
IPR000782 FAS1_domain
IPR036378 FAS1_dom_sf
IPR000538 Link_dom
IPR016187 CTDL_fold
IPR016186 C-type_lectin-like/link_sf
IPR002049 Laminin_EGF
IPR028974 TSP_type-3_rpt
IPR003367 Thrombospondin_3-like_rpt
IPR024665 Thbs/COMP_coiled-coil
IPR017897 Thrombospondin_3_rpt
IPR008859 Thrombospondin_C
IPR001881 EGF-like_Ca-bd_dom
IPR018097 EGF_Ca-bd_CS
IPR000859 CUB_dom
IPR035914 Sperma_CUB_dom_sf
IPR000152 EGF-type_Asp/Asn_hydroxyl_site
IPR013032 EGF-like_CS
IPR000742 EGF-like_dom
IPR024731 EGF_dom
IPR034036 ZnMP_TLD/BMP1
IPR015446 BMP_1/tolloid-like
IPR001506 Peptidase_M12A
IPR024079 MetalloPept_cat_dom_sf
IPR006026 Peptidase_Metallo
IPR029837 BMP-1
IPR001507 ZP_dom
IPR017977 ZP_dom_CS
IPR036772 SRCR-like_dom_sf
IPR001190 SRCR
IPR017448 SRCR-like_dom
IPR036770 Ankyrin_rpt-contain_sf
IPR010660 Notch_NOD_dom
IPR022362 Notch_1
IPR035993 Notch-like_dom_sf
IPR011656 Notch_NODP_dom
IPR020683 Ankyrin_rpt-contain_dom
IPR008297 Notch
IPR000800 Notch_dom
IPR002110 Ankyrin_rpt
IPR024600 DUF3454_notch
IPR022355 Notch_4
IPR022336 Notch_2
IPR022331 Notch_3
IPR001791 Laminin_G
IPR013320 ConA-like_dom_sf
IPR026219 Jagged/Serrate
IPR001007 VWF_dom
IPR011651 Notch_ligand_N
IPR001774 DSL
IPR036896 Avidin-like_sf
IPR005468 Avidin/str
IPR005469 Avidin
IPR017889 Avidin-like_CS
IPR033108 Jag2
IPR036116 FN3_sf
IPR035976 Sushi/SCR/CCP_sf
IPR013783 Ig-like_fold
IPR003961 FN3_dom
IPR000436 Sushi_SCR_CCP_dom
IPR003886 NIDO_dom
IPR017857 Coagulation_fac-like_Gla_dom
IPR000294 GLA_domain
IPR026823 cEGF
IPR035972 GLA-like_dom_SF
IPR036465 vWFA_dom_sf
IPR002035 VWF_A
IPR001759 Pentraxin-related
IPR003410 HYR_dom
IPR011641 Tyr-kin_ephrin_A/B_rcpt-like
IPR000782 FAS1_domain
IPR036378 FAS1_dom_sf
IPR000538 Link_dom
IPR016187 CTDL_fold
IPR016186 C-type_lectin-like/link_sf
IPR002049 Laminin_EGF
IPR028974 TSP_type-3_rpt
IPR003367 Thrombospondin_3-like_rpt
IPR024665 Thbs/COMP_coiled-coil
IPR017897 Thrombospondin_3_rpt
IPR008859 Thrombospondin_C
SUPFAM
Gene 3D
ProteinModelPortal
Q9W332.3
Q9TU53.1
O70244.2
Q9JLB4.3
O60494.5
Q20911.4
+ More
O57382.1 Q9WVM6.1 Q9Y6L7.1 O43897.1 Q8JI28.1 Q9DER7.1 O57460.1 Q62381.1 P98063.2 P13497.2 Q60997.2 P25723.2 Q01705.3 Q07008.3 G3I6Z6.2 P46531.4 A2RUV0.2 Q99466.2 P31695.3 P21783.3 Q04721.3 P14585.1 P46530.1 Q61982.1 O35516.2 Q9QW30.1 B8JI71.2 Q9R172.2 Q5T1H1.5 Q90Y54.1 Q5R6R1.3 Q90Y57.1 P10079.2 Q9UM47.2 Q5IJ48.2 A0A2K5V015.1 P78504.3 P07207.3 Q9QXX0.1 Q9QYE5.2 Q63722.2 Q80YA8.3 Q9Y219.3 P97607.1 P13508.1 Q8TER0.2 Q70E20.2 Q5ZQU0.2 P10040.3 P18168.3 Q61483.2 Q8VHS2.3 Q14393.3 P97677.1 Q6DI48.1 P0C6B8.1 Q8UWJ4.2 Q9IAT6.1 P10041.2 Q9NY15.3 Q4LDE5.3 Q8R4U0.1 P35443.2
O57382.1 Q9WVM6.1 Q9Y6L7.1 O43897.1 Q8JI28.1 Q9DER7.1 O57460.1 Q62381.1 P98063.2 P13497.2 Q60997.2 P25723.2 Q01705.3 Q07008.3 G3I6Z6.2 P46531.4 A2RUV0.2 Q99466.2 P31695.3 P21783.3 Q04721.3 P14585.1 P46530.1 Q61982.1 O35516.2 Q9QW30.1 B8JI71.2 Q9R172.2 Q5T1H1.5 Q90Y54.1 Q5R6R1.3 Q90Y57.1 P10079.2 Q9UM47.2 Q5IJ48.2 A0A2K5V015.1 P78504.3 P07207.3 Q9QXX0.1 Q9QYE5.2 Q63722.2 Q80YA8.3 Q9Y219.3 P97607.1 P13508.1 Q8TER0.2 Q70E20.2 Q5ZQU0.2 P10040.3 P18168.3 Q61483.2 Q8VHS2.3 Q14393.3 P97677.1 Q6DI48.1 P0C6B8.1 Q8UWJ4.2 Q9IAT6.1 P10041.2 Q9NY15.3 Q4LDE5.3 Q8R4U0.1 P35443.2
PDB
6GJE
E-value=0,
Score=2525
Ontologies
GO
GO:0097206
GO:0015031
GO:0097017
GO:0005886
GO:0005509
GO:0010008
GO:0016324
GO:0008203
GO:0031419
GO:0008144
GO:0031526
GO:0005765
GO:0006766
GO:0020028
GO:0001701
GO:0032991
GO:0030492
GO:0006898
GO:0038024
GO:0070207
GO:0007584
GO:0005905
GO:0043202
GO:0042802
GO:0016020
GO:0030666
GO:0005798
GO:0015889
GO:0030135
GO:0042366
GO:0038023
GO:0005737
GO:0045177
GO:0042953
GO:0005794
GO:0005768
GO:0030139
GO:0009617
GO:0070062
GO:0005783
GO:0042803
GO:0005903
GO:0009235
GO:0031232
GO:0001894
GO:0005829
GO:0034384
GO:0042359
GO:0005576
GO:0006629
GO:0007275
GO:0008270
GO:0004222
GO:0030154
GO:0048632
GO:0022617
GO:0001501
GO:0036342
GO:0035124
GO:0008233
GO:0001707
GO:0008237
GO:0035162
GO:0006508
GO:0009953
GO:0001568
GO:0001885
GO:0048264
GO:0030513
GO:0005518
GO:0005125
GO:0062023
GO:0005615
GO:0061036
GO:0051216
GO:0001503
GO:0031982
GO:0008083
GO:0001502
GO:0034380
GO:0005044
GO:0042589
GO:0050830
GO:0035375
GO:0030658
GO:0001833
GO:0050829
GO:0030670
GO:0009897
GO:0001824
GO:0016021
GO:0030858
GO:0031012
GO:0019898
GO:0032927
GO:0017015
GO:0007378
GO:0007313
GO:0008586
GO:0009880
GO:0016485
GO:0021915
GO:0035924
GO:0005112
GO:0003203
GO:0061384
GO:0005856
GO:0001889
GO:0043565
GO:0003162
GO:0010832
GO:0045668
GO:0045687
GO:0007050
GO:0000139
GO:0048708
GO:0030334
GO:0050434
GO:0045747
GO:0010628
GO:0060253
GO:0030326
GO:1903849
GO:0045893
GO:0008593
GO:2000737
GO:2001027
GO:0055008
GO:0060271
GO:0070374
GO:0045596
GO:0030514
GO:0003182
GO:0070986
GO:0072044
GO:0007492
GO:0048711
GO:0004888
GO:0003181
GO:0000978
GO:0060317
GO:0045618
GO:0001228
GO:0003198
GO:0005789
GO:0048845
GO:0003209
GO:0045607
GO:0009912
GO:0003344
GO:0048663
GO:0060843
GO:0090051
GO:0031069
GO:0045967
GO:0045892
GO:0048103
GO:0060982
GO:0061344
GO:0010001
GO:0003252
GO:0001726
GO:0060548
GO:0001947
GO:0061314
GO:0007507
GO:0071372
GO:0005654
GO:0008284
GO:0002052
GO:0032496
GO:0030182
GO:0002040
GO:0014031
GO:0003160
GO:0032495
GO:0021515
GO:0042127
GO:0072017
GO:0045608
GO:0030900
GO:0031410
GO:0035914
GO:0048873
GO:0003241
GO:0005634
GO:0007386
GO:0007221
GO:0003219
GO:0060528
GO:0060740
GO:0062043
GO:0008285
GO:0071944
GO:0002437
GO:0060956
GO:0045165
GO:0030216
GO:1901201
GO:0061419
GO:0008544
GO:0005887
GO:0010629
GO:0003157
GO:0043086
GO:0014807
GO:0003332
GO:0035148
GO:0003222
GO:0050767
GO:0050679
GO:0060768
GO:0045665
GO:0003180
GO:0043065
GO:0046579
GO:1902263
GO:0030027
GO:2000974
GO:0001837
GO:0043235
GO:0060411
GO:0046982
GO:0003256
GO:0035116
GO:0006959
GO:0060979
GO:0045955
GO:0046533
GO:0003151
GO:0045944
GO:0005912
GO:0060948
GO:0010718
GO:0003270
GO:0042246
GO:0072602
GO:0003208
GO:0031960
GO:0003192
GO:0007219
GO:0010614
GO:0003207
GO:0031100
GO:0003682
GO:0007409
GO:0003197
GO:2000811
GO:0070168
GO:0007283
GO:0030324
GO:0001708
GO:0007440
GO:0003700
GO:0090090
GO:0019899
GO:0003169
GO:0030335
GO:0045662
GO:0004857
GO:0010468
GO:0003213
GO:1902339
GO:0002051
GO:0046427
GO:0048754
GO:0060038
GO:0009986
GO:0001669
GO:0003184
GO:0060412
GO:0030279
GO:0000122
GO:0010812
GO:0060842
GO:0050678
GO:0060045
GO:0003264
GO:0072144
GO:0002193
GO:0120163
GO:0045603
GO:0003214
GO:0007368
GO:0003273
GO:0045070
GO:0048709
GO:1901189
GO:0048715
GO:0031490
GO:0006357
GO:0050768
GO:0007420
GO:0050793
GO:0005796
GO:0006355
GO:0001525
GO:0097150
GO:0006367
GO:0006955
GO:0045602
GO:0001886
GO:0001944
GO:0001569
GO:0030097
GO:0035278
GO:0045746
GO:0042060
GO:0001709
GO:0001763
GO:0030879
GO:0070613
GO:0045446
GO:0045766
GO:0032880
GO:0010838
GO:0006915
GO:0019827
GO:0060413
GO:0007399
GO:2001204
GO:0002315
GO:0009887
GO:0043066
GO:2000249
GO:0046849
GO:0048337
GO:0042661
GO:0045168
GO:0018991
GO:0043054
GO:0040028
GO:0001085
GO:0090575
GO:0040025
GO:0002119
GO:0042659
GO:0021986
GO:0001756
GO:0021531
GO:0001840
GO:0048699
GO:0048259
GO:0031016
GO:0009952
GO:0048936
GO:0031017
GO:0021514
GO:0042663
GO:0035907
GO:0021523
GO:0055016
GO:0002244
GO:0048844
GO:0072104
GO:0015629
GO:0048661
GO:0072015
GO:0005929
GO:0072014
GO:0035264
GO:0001890
GO:1990705
GO:0045672
GO:0035622
GO:0043011
GO:0060674
GO:0051059
GO:0072576
GO:0042742
GO:0061073
GO:0002011
GO:0072574
GO:0007015
GO:0033165
GO:0050896
GO:0007601
GO:0046549
GO:0035845
GO:0045494
GO:0005815
GO:0050908
GO:0001750
GO:0043403
GO:0030878
GO:0042472
GO:0031101
GO:0048752
GO:1904888
GO:0060325
GO:0032474
GO:0060351
GO:0060117
GO:0060872
GO:0060218
GO:0032579
GO:0045296
GO:0055111
GO:0010470
GO:0072358
GO:0010951
GO:0014028
GO:0007157
GO:0045197
GO:0019828
GO:0045199
GO:0044877
GO:0045599
GO:0001953
GO:0061156
GO:0035909
GO:0061444
GO:0030336
GO:0045639
GO:0005543
GO:0045669
GO:0072006
GO:0061309
GO:0022408
GO:0005198
GO:0001974
GO:0003215
GO:0045445
GO:0002456
GO:0042491
GO:0072070
GO:0035204
GO:0048749
GO:1900087
GO:0008356
GO:0008347
GO:0043525
GO:0030720
GO:0060250
GO:0007519
GO:0030713
GO:0035003
GO:0022416
GO:0036099
GO:0007398
GO:0045466
GO:0007314
GO:0016360
GO:0050877
GO:0007473
GO:2000035
GO:0007298
GO:0005915
GO:2000048
GO:0005769
GO:0048665
GO:0007451
GO:0035153
GO:0061382
GO:0060571
GO:0007450
GO:0007346
GO:0007422
GO:0048052
GO:0008045
GO:0035172
GO:0007474
GO:0042691
GO:0048863
GO:0046666
GO:0035214
GO:0042689
GO:0008587
GO:0007405
GO:0046667
GO:0060289
GO:0046329
GO:0016348
GO:0042676
GO:0045316
GO:0035222
GO:0001745
GO:0035165
GO:0060288
GO:0048664
GO:0040008
GO:0035171
GO:0048190
GO:0007498
GO:0007464
GO:0036011
GO:0014019
GO:0008407
GO:0042688
GO:0048803
GO:1902692
GO:1990433
GO:0030708
GO:0007297
GO:0002213
GO:0007476
GO:0048542
GO:0046843
GO:0007446
GO:0007400
GO:0009608
GO:0016333
GO:0016330
GO:0007419
GO:0043697
GO:0035167
GO:0007423
GO:0007411
GO:0030718
GO:0007616
GO:0007455
GO:0006110
GO:0046331
GO:0008340
GO:0007403
GO:0009950
GO:0046716
GO:0042067
GO:0036335
GO:0051489
GO:0007391
GO:0007447
GO:0005770
GO:0030707
GO:0042686
GO:0048477
GO:0007478
GO:0061331
GO:0007521
GO:0005788
GO:0045595
GO:0007293
GO:0048018
GO:0043010
GO:0048839
GO:0030155
GO:0030217
GO:0045061
GO:1990134
GO:0042475
GO:0007605
GO:0042492
GO:0016331
GO:0003016
GO:0048471
GO:0001666
GO:0008584
GO:0012505
GO:0043282
GO:0043055
GO:2000648
GO:1905938
GO:0044214
GO:0016328
GO:0003713
GO:1905936
GO:0007160
GO:0035332
GO:0016332
GO:0003383
GO:0061024
GO:0005080
GO:0046621
GO:0007163
GO:0106036
GO:0035239
GO:0061336
GO:0007443
GO:0007435
GO:0005819
GO:0046664
GO:0007424
GO:0032435
GO:0035090
GO:0045570
GO:0098813
GO:0016028
GO:0033157
GO:0061541
GO:0016334
GO:0051642
GO:0046665
GO:0034332
GO:0042051
GO:0045186
GO:0030507
GO:0035088
GO:0045176
GO:0050821
GO:0045218
GO:0060438
GO:0051301
GO:0042052
GO:0016327
GO:0035002
GO:0043208
GO:0045179
GO:0035017
GO:0007436
GO:0048100
GO:0030673
GO:0014009
GO:0097110
GO:0097009
GO:0048633
GO:0098773
GO:0035265
GO:1903672
GO:0001757
GO:0009954
GO:0014002
GO:0008217
GO:0007267
GO:0030957
GO:0021510
GO:0021693
GO:0072583
GO:0032693
GO:0034351
GO:0060041
GO:2000726
GO:0097102
GO:1900746
GO:0030857
GO:0045605
GO:0051302
GO:0048630
GO:0060042
GO:0045121
GO:0003323
GO:0045638
GO:0021688
GO:0048631
GO:0045807
GO:0060853
GO:0001917
GO:0005902
GO:0042462
GO:0005913
GO:0007009
GO:0030296
GO:0043027
GO:0046827
GO:0035690
GO:0006468
GO:0085029
GO:0002576
GO:0050711
GO:0007155
GO:0031093
GO:0061098
GO:0043154
GO:0019064
GO:0043687
GO:1900142
GO:0007165
GO:0043491
GO:0016477
GO:0097028
GO:0043433
GO:0070588
GO:0048146
GO:0032148
GO:0001961
GO:0033138
GO:0018105
GO:2000533
GO:0030168
GO:0051897
GO:0019079
GO:2000352
GO:0001764
GO:0070527
GO:0032689
GO:0046718
GO:0005245
GO:0032008
GO:0001786
GO:0001934
GO:0035754
GO:0031589
GO:0050900
GO:2000669
GO:0007167
GO:0072659
GO:0035457
GO:0010934
GO:0006888
GO:0005102
GO:0032720
GO:0046813
GO:0071307
GO:0045860
GO:0043277
GO:0032715
GO:2000270
GO:0044267
GO:0050766
GO:0030971
GO:0010804
GO:0006909
GO:0032825
GO:0030674
GO:0097241
GO:1900165
GO:0009267
GO:0071333
GO:0008283
GO:2000510
GO:0003104
GO:0071363
GO:0021536
GO:0060034
GO:0005938
GO:0014032
GO:0022008
GO:0060113
GO:0030901
GO:0033504
GO:0061056
GO:0048546
GO:1902036
GO:0035469
GO:0003140
GO:0030165
GO:0071910
GO:0048666
GO:0048514
GO:0007475
GO:0048800
GO:0007480
GO:0045931
GO:0005041
GO:0030169
GO:0015035
GO:0006954
GO:0005540
GO:0016525
GO:0006897
GO:0005604
GO:0008201
GO:0034103
GO:0005178
GO:0048771
GO:0071603
GO:0051451
GO:0016529
GO:0050731
GO:0048266
GO:0001938
GO:0090023
GO:0034976
GO:0006986
GO:0051781
GO:0005515
GO:0005840
GO:0006412
GO:0015934
GO:0015914
GO:0046872
GO:0016876
GO:0043039
PANTHER
Topology
Subcellular location
Cell membrane
Endosome membrane Colocalizes with AMN and LRP2 in the endocytotic apparatus of epithelial cells. With evidence from 1 publications.
Lysosome membrane Colocalizes with AMN and LRP2 in the endocytotic apparatus of epithelial cells. With evidence from 1 publications.
Apical cell membrane Colocalizes with AMN and LRP2 in the endocytotic apparatus of epithelial cells. With evidence from 1 publications.
Membrane Colocalizes with AMN and LRP2 in the endocytotic apparatus of epithelial cells. With evidence from 1 publications.
Coated pit Colocalizes with AMN and LRP2 in the endocytotic apparatus of epithelial cells. With evidence from 1 publications.
Endosome Colocalizes with AMN and LRP2 in the endocytotic apparatus of epithelial cells. With evidence from 1 publications.
Secreted
Golgi apparatus
trans-Golgi network
Extracellular space
Extracellular matrix
Cytoplasmic vesicle
Secretory vesicle membrane
Nucleus Following proteolytical processing NICD is translocated to the nucleus. Nuclear location may require MEGF10. With evidence from 35 publications.
Cytoplasm Following proteolytical processing NICD is translocated to the nucleus. Retained at the cytoplasm by TCIM (PubMed:25985737). With evidence from 26 publications.
Cell projection Localizes to discrete puncta at, or adjacent to, the photoreceptor connecting cilium (PubMed:27737822, PubMed:30052645). May localize to the cilium axoneme (By similarity). May also be expressed in the interphotoreceptor extracellular matrix (By similarity). Unlike the primate ortholog, does not appear to be expressed in the photoreceptor outer segment (PubMed:27737822). With evidence from 1 publications.
Cilium Localizes to discrete puncta at, or adjacent to, the photoreceptor connecting cilium (PubMed:27737822, PubMed:30052645). May localize to the cilium axoneme (By similarity). May also be expressed in the interphotoreceptor extracellular matrix (By similarity). Unlike the primate ortholog, does not appear to be expressed in the photoreceptor outer segment (PubMed:27737822). With evidence from 1 publications.
Cytoskeleton Localizes to discrete puncta at, or adjacent to, the photoreceptor connecting cilium (PubMed:27737822, PubMed:30052645). May localize to the cilium axoneme (By similarity). May also be expressed in the interphotoreceptor extracellular matrix (By similarity). Unlike the primate ortholog, does not appear to be expressed in the photoreceptor outer segment (PubMed:27737822). With evidence from 1 publications.
Cilium axoneme Localizes to discrete puncta at, or adjacent to, the photoreceptor connecting cilium (PubMed:27737822, PubMed:30052645). May localize to the cilium axoneme (By similarity). May also be expressed in the interphotoreceptor extracellular matrix (By similarity). Unlike the primate ortholog, does not appear to be expressed in the photoreceptor outer segment (PubMed:27737822). With evidence from 1 publications.
Interphotoreceptor matrix Localizes to discrete puncta at, or adjacent to, the photoreceptor connecting cilium (PubMed:27737822, PubMed:30052645). May localize to the cilium axoneme (By similarity). May also be expressed in the interphotoreceptor extracellular matrix (By similarity). Unlike the primate ortholog, does not appear to be expressed in the photoreceptor outer segment (PubMed:27737822). With evidence from 1 publications.
Photoreceptor outer segment Localizes to discrete puncta at, or adjacent to, the photoreceptor connecting cilium (PubMed:27737822). Highly expressed in cone photoreceptor outer segments (PubMed:27737822). Weakly expressed in rod photoreceptor outer segments (By similarity). May localize to the cilium axoneme (PubMed:27846257). May also be secreted into the interphotoreceptor extracellular matrix (PubMed:27737822). With evidence from 2 publications.
Microtubule organizing center Localizes to discrete puncta at, or adjacent to, the photoreceptor connecting cilium (PubMed:27737822). Highly expressed in cone photoreceptor outer segments (PubMed:27737822). Weakly expressed in rod photoreceptor outer segments (By similarity). May localize to the cilium axoneme (PubMed:27846257). May also be secreted into the interphotoreceptor extracellular matrix (PubMed:27737822). With evidence from 2 publications.
Centrosome Localizes to discrete puncta at, or adjacent to, the photoreceptor connecting cilium (PubMed:27737822). Highly expressed in cone photoreceptor outer segments (PubMed:27737822). Weakly expressed in rod photoreceptor outer segments (By similarity). May localize to the cilium axoneme (PubMed:27846257). May also be secreted into the interphotoreceptor extracellular matrix (PubMed:27737822). With evidence from 2 publications.
Hyaline layer
Apical lamina
Spindle Specifically localized to the apical membrane (PubMed:11076972, PubMed:2344615). Expressed in a mesh punctate pattern that overlaps with metaphase spindle microtubules (PubMed:25065591). In tracheal cells, colocalizes with apn in the subapical region, a small region of the apical membrane apical to the adherens junctions (PubMed:30645584). With evidence from 7 publications.
Cell junction Distributed around adherens junction in the apical endfeet through interactions with MAGI1. With evidence from 12 publications.
Adherens junction Distributed around adherens junction in the apical endfeet through interactions with MAGI1. With evidence from 12 publications.
Membrane raft Distributed around adherens junction in the apical endfeet through interactions with MAGI1. With evidence from 12 publications.
Endoplasmic reticulum
Sarcoplasmic reticulum
Endosome membrane Colocalizes with AMN and LRP2 in the endocytotic apparatus of epithelial cells. With evidence from 1 publications.
Lysosome membrane Colocalizes with AMN and LRP2 in the endocytotic apparatus of epithelial cells. With evidence from 1 publications.
Apical cell membrane Colocalizes with AMN and LRP2 in the endocytotic apparatus of epithelial cells. With evidence from 1 publications.
Membrane Colocalizes with AMN and LRP2 in the endocytotic apparatus of epithelial cells. With evidence from 1 publications.
Coated pit Colocalizes with AMN and LRP2 in the endocytotic apparatus of epithelial cells. With evidence from 1 publications.
Endosome Colocalizes with AMN and LRP2 in the endocytotic apparatus of epithelial cells. With evidence from 1 publications.
Secreted
Golgi apparatus
trans-Golgi network
Extracellular space
Extracellular matrix
Cytoplasmic vesicle
Secretory vesicle membrane
Nucleus Following proteolytical processing NICD is translocated to the nucleus. Nuclear location may require MEGF10. With evidence from 35 publications.
Cytoplasm Following proteolytical processing NICD is translocated to the nucleus. Retained at the cytoplasm by TCIM (PubMed:25985737). With evidence from 26 publications.
Cell projection Localizes to discrete puncta at, or adjacent to, the photoreceptor connecting cilium (PubMed:27737822, PubMed:30052645). May localize to the cilium axoneme (By similarity). May also be expressed in the interphotoreceptor extracellular matrix (By similarity). Unlike the primate ortholog, does not appear to be expressed in the photoreceptor outer segment (PubMed:27737822). With evidence from 1 publications.
Cilium Localizes to discrete puncta at, or adjacent to, the photoreceptor connecting cilium (PubMed:27737822, PubMed:30052645). May localize to the cilium axoneme (By similarity). May also be expressed in the interphotoreceptor extracellular matrix (By similarity). Unlike the primate ortholog, does not appear to be expressed in the photoreceptor outer segment (PubMed:27737822). With evidence from 1 publications.
Cytoskeleton Localizes to discrete puncta at, or adjacent to, the photoreceptor connecting cilium (PubMed:27737822, PubMed:30052645). May localize to the cilium axoneme (By similarity). May also be expressed in the interphotoreceptor extracellular matrix (By similarity). Unlike the primate ortholog, does not appear to be expressed in the photoreceptor outer segment (PubMed:27737822). With evidence from 1 publications.
Cilium axoneme Localizes to discrete puncta at, or adjacent to, the photoreceptor connecting cilium (PubMed:27737822, PubMed:30052645). May localize to the cilium axoneme (By similarity). May also be expressed in the interphotoreceptor extracellular matrix (By similarity). Unlike the primate ortholog, does not appear to be expressed in the photoreceptor outer segment (PubMed:27737822). With evidence from 1 publications.
Interphotoreceptor matrix Localizes to discrete puncta at, or adjacent to, the photoreceptor connecting cilium (PubMed:27737822, PubMed:30052645). May localize to the cilium axoneme (By similarity). May also be expressed in the interphotoreceptor extracellular matrix (By similarity). Unlike the primate ortholog, does not appear to be expressed in the photoreceptor outer segment (PubMed:27737822). With evidence from 1 publications.
Photoreceptor outer segment Localizes to discrete puncta at, or adjacent to, the photoreceptor connecting cilium (PubMed:27737822). Highly expressed in cone photoreceptor outer segments (PubMed:27737822). Weakly expressed in rod photoreceptor outer segments (By similarity). May localize to the cilium axoneme (PubMed:27846257). May also be secreted into the interphotoreceptor extracellular matrix (PubMed:27737822). With evidence from 2 publications.
Microtubule organizing center Localizes to discrete puncta at, or adjacent to, the photoreceptor connecting cilium (PubMed:27737822). Highly expressed in cone photoreceptor outer segments (PubMed:27737822). Weakly expressed in rod photoreceptor outer segments (By similarity). May localize to the cilium axoneme (PubMed:27846257). May also be secreted into the interphotoreceptor extracellular matrix (PubMed:27737822). With evidence from 2 publications.
Centrosome Localizes to discrete puncta at, or adjacent to, the photoreceptor connecting cilium (PubMed:27737822). Highly expressed in cone photoreceptor outer segments (PubMed:27737822). Weakly expressed in rod photoreceptor outer segments (By similarity). May localize to the cilium axoneme (PubMed:27846257). May also be secreted into the interphotoreceptor extracellular matrix (PubMed:27737822). With evidence from 2 publications.
Hyaline layer
Apical lamina
Spindle Specifically localized to the apical membrane (PubMed:11076972, PubMed:2344615). Expressed in a mesh punctate pattern that overlaps with metaphase spindle microtubules (PubMed:25065591). In tracheal cells, colocalizes with apn in the subapical region, a small region of the apical membrane apical to the adherens junctions (PubMed:30645584). With evidence from 7 publications.
Cell junction Distributed around adherens junction in the apical endfeet through interactions with MAGI1. With evidence from 12 publications.
Adherens junction Distributed around adherens junction in the apical endfeet through interactions with MAGI1. With evidence from 12 publications.
Membrane raft Distributed around adherens junction in the apical endfeet through interactions with MAGI1. With evidence from 12 publications.
Endoplasmic reticulum
Sarcoplasmic reticulum
Length:
3115
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.11214
Exp number, first 60 AAs:
0.00096
Total prob of N-in:
0.00006
outside
1 - 3115
Population Genetic Test Statistics
Pi
2.779429
Theta
3.50596
Tajima's D
-0.942943
CLR
1.374039
CSRT
0.145992700364982
Interpretation
Uncertain
