SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08019
Annotation
T18197_reverse_transcriptase-like_protein_-_silkworm
Full name
Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2       + More
Retrovirus-related Pol polyprotein from type-2 retrotransposable element R2DM      
Alternative Name
Retrovirus-related Pol polyprotein from type I retrotransposable element R2
Retrovirus-related Pol polyprotein from type II retrotransposable element R2DM
Location in the cell
Mitochondrial   Reliability : 2.195
 

Sequence

CDS
ATGTCGCCCGATGCCGCTCGGGTTCTCTCCGAACTCCTTGAGGGTGCGGGGAGAAGACGAGCGTGCAGGGCTATGAGACCCAAGACTGCAGGGCGGCGAAACGATTTGCACGATGATCGGACAGCTAGTGCCCACAAAACCAGTAGACAAAAGCGCAGGGCAGAGTACGCGCGTGTGCAGGAACTGTACAAGAAGTGTCGCAGCAGAGCAGCAGCTGAGGTGATCGATGGCGCGTGTGGGGGTGTCGGACACTCGCTCGAGGAGATGGAGACCTATTGGCGACCTATCCTCGAGAGAGTGTCCGATGCACCTGGGCCTACACCGGAAGCTCTTCACGCCCTAGGGCGTGCGGAGTGGCACGGGGGCAATAGCGACTACACCCAGCTGTGGAAGCCGATCTCGGTGGAAGAGATCAAGGCCTCCCGCTTTGACTGGCGAACTTCGCCGGGCCCGGACGGTATACGTTCGGGTCAGTGGCGTGCGGTTCCTGTGCACTTGAAGGCGGAAATGTTCAATGCATGGATGGCACGAGGCGAAATACCCGAAATTCTACGGCAGTGCCGAACCGTCTTTGTACCTAAGGTGGAGAGACCAGGTGGACCGGGGGAATATCGACCGATCTCGATCGCGTCGATTCCCCTGAGACACTTTCACTCCATCTTGGCCCGGAGGCTGTTGGCTTGCTGCCCCCCTGATGCACGACAGCGCGGATTTATCTGCGCCGACGGTACGCTGGAGAATTCCGCAGTACTGGACGCGGTGCTTGGGGATAGCAGGAAGAAGCTGCGGGAATGTCACGTGGCGGTGCTAGACTTCGCCAAGGCATTTGACACAGTGTCTCACGAGGCACTTGTCGAATTGCTGAGGTTGAGGGGCATGCCCGAACAGTTCTGCGGCTACATTGCTCACCTATACGATACGGCGTCCACCACCTTAGCCGTGAACAATGAAATGAGCAGCCCTGTAAAAGTGGGACGAGGGGTTCGTCAAGGGGACCCTCTGTCGCCGATACTCTTCAACGTGGTGATGGACCTCATCCTGGCTTCCCTGCCGGAGAGGGTCGGGTATAGGTTGGAGATGGAACTAGTGTCCGCTCTGGCCTATGCTGACGACCTAGTCCTGCTTGCGGGGTCGAAGGTAGGGATGCAGGAGTCCATCTCTGCTGTGGACTGTGTCGGTAGGCAGATGGGCCTACGCCTGAATTGCAGGAAAAGCGCGGTTCTGTCTATGATACCGGATGGCCACCGCAAGAAGCATCACTACCTGACTGAGCGAACCTTCAATATTGGAGGTAAGCCGCTCAGGCAGGTGAGTTGTGTTGAGCGGTGGCGATATCTTGGTGTCGATTTTGAGGCCTCTGGATGCGTGACATTAGAGCATAGTATCAGTAGTGCTCTGAATAACATCTCAAGGGCACCTCTCAAACCCCAACAGAGGTTGGAGATTTTGAGAGCTCATCTGATTCCGAGATTCCAGCACGGTTTTGTGCTTGGAAACATCTCGGATGACCGATTGAGAATGCTCGATGTCCAAATCCGGAAAGCAGTCGGACAGTGGCTAAGGCTACCGGCGGATGTGCCCAAGGCATATTATCACGCCGCAGTTCAGGACGGCGGCTTAGCGATCCCATCGGTGCGAGCGACCATCCCGGACCTCATTGTGAGGCGTTTCGGGGGGCTCGACTCGTCACCATGGTCAGTGGCAAGAGCCGCCGCCAAATCTGATAAGATTCGTGGTCTCGGGCCAGCGATCGTTTGA
Protein
MSPDAARVLSELLEGAGRRRACRAMRPKTAGRRNDLHDDRTASAHKTSRQKRRAEYARVQELYKKCRSRAAAEVIDGACGGVGHSLEEMETYWRPILERVSDAPGPTPEALHALGRAEWHGGNSDYTQLWKPISVEEIKASRFDWRTSPGPDGIRSGQWRAVPVHLKAEMFNAWMARGEIPEILRQCRTVFVPKVERPGGPGEYRPISIASIPLRHFHSILARRLLACCPPDARQRGFICADGTLENSAVLDAVLGDSRKKLRECHVAVLDFAKAFDTVSHEALVELLRLRGMPEQFCGYIAHLYDTASTTLAVNNEMSSPVKVGRGVRQGDPLSPILFNVVMDLILASLPERVGYRLEMELVSALAYADDLVLLAGSKVGMQESISAVDCVGRQMGLRLNCRKSAVLSMIPDGHRKKHHYLTERTFNIGGKPLRQVSCVERWRYLGVDFEASGCVTLEHSISSALNNISRAPLKPQQRLEILRAHLIPRFQHGFVLGNISDDRLRMLDVQIRKAVGQWLRLPADVPKAYYHAAVQDGGLAIPSVRATIPDLIVRRFGGLDSSPWSVARAAAKSDKIRGLGPAIV

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Keywords
Complete proteome   Endonuclease   Hydrolase   Metal-binding   Nuclease   Nucleotidyltransferase   Reference proteome   RNA-directed DNA polymerase   Transferase   Transposable element   Zinc   Zinc-finger   Aspartyl protease   Protease  
Feature
chain  Retrovirus-related Pol polyprotein from type-1 retrotransposable element R2
EMBL
M16558    AAB59214.1    AB076841    BAC01114.1    AF436853    AAQ04479.1    + More
GBBI01004849    JAC13863.1    GBYB01008309    JAG78076.1    LBMM01006940    KMQ90176.1    AAZX01002322    LBMM01007077    KMQ90064.1    UFQS01003262    UFQT01003262    SSX15424.1    SSX34793.1    GGMS01004512    MBY73715.1    GBBI01004905    JAC13807.1    GBBI01004906    JAC13806.1    L00950    AAZX01010802    AAZX01015897    KQ971997    KYB24671.1    FJ461304    ACJ71597.1    AAZX01023287    AAZX01023288    GBRD01016678    JAG49149.1    GBHO01045037    GBHO01045036    JAF98566.1    JAF98567.1    GDHC01017848    JAQ00781.1    AB097121    BAC82589.1    X51967    GFTR01008394    JAW08032.1    GFJQ02001120    JAW05850.1    GFWV01007503    MAA32233.1    GFWV01002964    MAA27694.1    GEDV01005279    JAP83278.1    GFWV01001114    MAA25844.1    KJ958674    AIL01110.1    AB097122    BAC82590.1    GEDV01003881    JAP84676.1    GFAC01005869    JAT93319.1    GFWV01012635    MAA37364.1    JQ082370    AFM44926.1    AF015819    AAC34906.1    JN937619    AFO19998.1    JN937617    AFO19996.1    AAZX01010801    AAZX01015898    AAZX01024756    AAZX01024918    GFAC01000014    JAT99174.1    GACK01007407    JAA57627.1    EU854578    ACJ46647.1    L00951    AF015815    AAC34903.1    KK855758    PTY23787.1    AF015685    AAB94032.1    GFAC01003453    JAT95735.1    LBMM01009160    KMQ88340.1    GBRD01002048    JAG63773.1    AB097123    BAC82591.1    AAZX01010936    KF925878    AHN53448.1    ABLF02003433    GFJQ02003336    JAW03634.1    UZAN01004728    VDP32110.1    JN937618    AFO19997.1    GFAC01005513    JAT93675.1    JN937616    AFO19995.1    LBMM01006509    KMQ90547.1    NIRI01002286    RJW62659.1    NIRI01000035    RJW73594.1    UYRU01007376    VDK41074.1    NIRI01000032    RJW73696.1    UZAI01021487    VDP55649.1    KL596651    KER31070.1    AHAT01035183    BN000800    CAJ00246.1    GCES01136315    JAQ50007.1    GCES01125908    JAQ60414.1    GCES01088356    JAQ97966.1    GCES01115013    JAQ71309.1    LC155026    BAX24488.1    UZAI01007624    VDO99720.1    LC349444    BBC20536.1    GCES01097919    JAQ88403.1    UYRU01077406    VDN28088.1    AB097124    BAC82592.1    AHAT01039632    KL367913    KFD59471.1   
Pfam
PF00078   RVT_1        + More
PF00096   zf-C2H2
PF08356   EF_assoc_2
PF08355   EF_assoc_1
PF00071   Ras
PF13202   EF-hand_5
PF00249   Myb_DNA-binding
Interpro
IPR013087   Znf_C2H2_type        + More
IPR000477   RT_dom       
IPR036236   Znf_C2H2_sf       
IPR001005   SANT/Myb       
IPR013567   EF_hand_assoc_2       
IPR018247   EF_Hand_1_Ca_BS       
IPR020860   MIRO_dom       
IPR013566   EF_hand_assoc_1       
IPR027417   P-loop_NTPase       
IPR001806   Small_GTPase       
IPR011992   EF-hand-dom_pair       
IPR002048   EF_hand_dom       
IPR017930   Myb_dom       
SUPFAM
SSF57667   SSF57667        + More
SSF52540   SSF52540       
SSF47473   SSF47473       
PDB
6AR3     E-value=0.0405922,     Score=88

Ontologies

Topology

Length:
585
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0036
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00051
outside
1  -  585
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
12.249172
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号