SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08018
Pre Gene Modal
BGIBMGA010315
Annotation
Gag-like_protein_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 2.546
 

Sequence

CDS
ATGAGAAGCAATCACTTCAAAAGTATTGATGGAGGGCCGCGTGGACCCTCAGCTGTTAGAAAACGCTCACGCGACAATGCTCCAGTGGGAGATGGGTCAGTGGACCTGTCCTCAGATGAGGAAGGCCTGCTGCCCCCGAAGAAATTGCCGACCACGAGAAGAGTTCGGCAGGTTTCGAGAGGGATGAGTGCTTCACGGCCGCGGAGGAACGCACAGGGTAGGTTCGTGTGCTTCAATACTCCGGCGGCCAGTAAAGCAGATAGTGACATGGGGGTCACTACCGAAGACCCTGGTGGCGAGAGCTGTGCCTCGCTAGGGAGCTCAAAGGCGGAGATCAACGCCGCCAGAAGAGAGCAGCGCAAAGCCGTCGCGGCCGACGAACTTGCCTTGGACGGGGTGGACTTAGTTCTGAAGGTTGCCACCAAATCCGGCAGCCTGAAGGGTACGTTCACCCGCGGTCTGAAGGAAGCTGCCGCAGACATTAAGGAGGCGATTGGCATCCTCCTCAACAGGACGGCCTCTGACGAGGTTGCGAAGTTGCAGGAGGAAAACAGCCGTCTCCGAAATGATATGGAGGACCTCCGGCGACGAGTCACTGCGTTGAGCGAGCAGCAGCAGCGACGTACGTCCACTGATGCCGCATCGGTAGTGGCCCCGGCTCTCGCACCGAGACCGGTAAGCACTCATACCGACGATGAGGTCGAGCGCATTGTCCGGCTCTGCATGCTCCAGTGCGGGAGCATGGTCAATGCTCGTATGGAGGCAATTTCTCGGCGCCTCCCTGCGGAAATCCTCCGTCCGCCACTAGCGGCCGATACACGGCGGAGGGTTGAGGAGCCGCCGAGACCTAAGCCTAGGGAGGGGAAACCCGCGGAGGGTGTTAAAAAGCCCGTCGAGGGAGCCCCATCGAGCGATCAGCCCACGACTGCTGGGTCTAAGGGTGAGACCTGGGTTACAGTCATGGGCCGCAAGAAGGCACGCAAGGCCGCCAAGGCGGCCTCAGCAGCAACGCATGCCCCCGGCCAAACCGCAAAGGCGGTTGCGCAGCCTGCGCGGCGGACTGCCAAAGGCGGTCGCAAAGGACTGGTGATACGTGCTCCACGATCCGAAGCTGTGACGCTCACGCTACAGCCCGGAGCTGCGGAGCGCGGCGTAACGTACCAGTCGGTCATCGCCGAAGCCAAGGCCAAGATCAAATTATCAGATCTTGGTCTTCAGGCCGCCACCCGCAGGCAGGCTGCCACGGGTGCACGGCTGTTCGAGGTGGCTGGTACTGCGAGTGGCAGTGCCGAAAAGGCGGACGCTCTGGCCGCCAAGATGAGGGAGGTCCTCAGCCCCGAGGACGTCCGGGTCTCCAGGCCAATGAAAACCGCAGAGGTGCGGATTGCTGGCCTGGATGACTCCGTGACCTCTGAGGAGGTGGTAGCGGCCGTTGCCCGAAGTGGAGAGTGTCCATCGGACAAGGTGCGGGCCGGTGATATACGCACCGACGCCACCAGACTCGGCGTGGTCTGGGTTCGGTGCCCTGTAGCGTCGGCGAAAAAGATCGCCTTAAGCGGCAGATTGCTGGTTTTGCAGTCCGGGTCGTTTCGTAATGGCGATGTGCCATAA
Protein
MRSNHFKSIDGGPRGPSAVRKRSRDNAPVGDGSVDLSSDEEGLLPPKKLPTTRRVRQVSRGMSASRPRRNAQGRFVCFNTPAASKADSDMGVTTEDPGGESCASLGSSKAEINAARREQRKAVAADELALDGVDLVLKVATKSGSLKGTFTRGLKEAAADIKEAIGILLNRTASDEVAKLQEENSRLRNDMEDLRRRVTALSEQQQRRTSTDAASVVAPALAPRPVSTHTDDEVERIVRLCMLQCGSMVNARMEAISRRLPAEILRPPLAADTRRRVEEPPRPKPREGKPAEGVKKPVEGAPSSDQPTTAGSKGETWVTVMGRKKARKAAKAASAATHAPGQTAKAVAQPARRTAKGGRKGLVIRAPRSEAVTLTLQPGAAERGVTYQSVIAEAKAKIKLSDLGLQAATRRQAATGARLFEVAGTASGSAEKADALAAKMREVLSPEDVRVSRPMKTAEVRIAGLDDSVTSEEVVAAVARSGECPSDKVRAGDIRTDATRLGVVWVRCPVASAKKIALSGRLLVLQSGSFRNGDVP

Summary

Pfam
PF00098   zf-CCHC
Interpro
IPR036875   Znf_CCHC_sf        + More
IPR001878   Znf_CCHC       
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF57756   SSF57756        + More
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
536
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00611
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00279
outside
1  -  536
 
 

Population Genetic Test Statistics

Pi
3.53614
Theta
15.39417
Tajima's D
-1.516278
CLR
0.294352
CSRT
0.0543972801359932
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号