SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08014
Annotation
gag-like_protein_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.348
 

Sequence

CDS
ATGAGTGAAGATTGTGTCAGTGAAAGTGCTAGTGACATTGTCGGGTTCCTCCGGGATAGGTACCCGTCAATTAGGGCCGAGTACTTAGCGTATAGGGCCTCCCGTGGCAATCCCTCCCCCCCCGCGTCCGTCGCCGCGTATTTCAACCGTGCCTCGGAGGCACGCCGCGCGCCCCCCGCCGCCGCGTTAAGTTCGAGCGCACGTTCCAACGATGCGACTCACGAAGCGCCTAGCGCTACCCCCACCCCCGCGCCCGCGTCGGTTACGTCATCACGCGCTACGTCCGCCGCGACCTCGATCATTTCAAGTTCAGGCTCCGATACCGAATCGGAGATGGATTTCGAATCCGCGTCAAGCCCTCAGCCTGGAACTTCGGATGGGTTCCAAACCGTAACGCGCGGTAAAAAGCGTACTCGCGCCGTGGAGTCCCGGAACTCCACGACAAAACAAACGAAATCCGCGTCCGCCTCTCGACCAAAAGTAGTAGTAACACCGGAGTCGGACTCCGCGCGCCGCGTAACCCCACCGCCGCGTCCCAAGCCCGCGCCCGCTCCCAAAGTAGCTGCCCCGCCCCCGCTGATACTTCAAGAGAAGACAGCGTGGAATCGCGTGTCCCAGGCCCTTCAGGCAAATAAAATTAACTACACCCATGCGCGTAACGTCGCGCATGGGATTCAGATCAAGGTCGCAACGCCGGGCGACCATAGGGCCCTCTCAGCATACCTCCGAAAGGAGAACATAGGTTTCCACACCTATGCTCTTCAGGAGGACCGCGAGCTCCGCGTAGTAATACGCGGAGTCCCTAAGGAGCTAGAAATAGACTACATTAAGGAGGATCTGACCGCTCAGGCCCTCCCGATAGTTAGTGTGCACCGGATGCACAGCGGGCGGGGCAAACAGCCCTATAATATGATACTCGTGGCGTTAGAACCCACCCCGGAGGCCAAAAAGAAGATCGCATGTCTCACGACAATTTGCGGCCTATCCGGGATATCGATCGAAGCCCCCCATAAGCGTGGCACTCCCGGGCAGTGCTACAGGTGCCAACTCTATGGCCACTCGGCGCGTAATTGCCACGCGCGTCCCCGCTGCGTGAAATGCCTCGGCGATCACGCTACGTTAGATTGCGTTAGAGATAGGGAAACCGCGACCGAACCTCCCAGCTGTGTCCTATGCCTTAAGCAAGGGCACCCCGCGAACTACCGTGGATGTCCCAGGGCTCCGCGAAAACGCCCAACCCACCCAGCTCCGCGAACCGTCGGCCCAAAGACTTCGGCACCCTCAGTGCCGAAACCTGCCTTCGTGCCGGCTGCAGTTCCCACGGTTTCAGCGTGGAAAAAGCCGCTGCCGTATACGAAGGCGGGAACGCAAACCGCACCCCCGCCCCCGCTCGCGACACGCCCCGCGCCTCAGCCCCTGCTCGCACCTCGCCCCGCGCCCGCGTTCCGTCCCCCGCAACCCTCTGCCGCCAACGACTTCGCGCTCGTGCGCGACTTCGTCACCGCGGTGAACTTCGACCGTCTGCGATCGTTCGCTGACGCTATCCGTAGGTCGACAACCCCCGAACAGCGGCTCGCGGCCGCGTTCGATCACATGGACGTTTAA
Protein
MSEDCVSESASDIVGFLRDRYPSIRAEYLAYRASRGNPSPPASVAAYFNRASEARRAPPAAALSSSARSNDATHEAPSATPTPAPASVTSSRATSAATSIISSSGSDTESEMDFESASSPQPGTSDGFQTVTRGKKRTRAVESRNSTTKQTKSASASRPKVVVTPESDSARRVTPPPRPKPAPAPKVAAPPPLILQEKTAWNRVSQALQANKINYTHARNVAHGIQIKVATPGDHRALSAYLRKENIGFHTYALQEDRELRVVIRGVPKELEIDYIKEDLTAQALPIVSVHRMHSGRGKQPYNMILVALEPTPEAKKKIACLTTICGLSGISIEAPHKRGTPGQCYRCQLYGHSARNCHARPRCVKCLGDHATLDCVRDRETATEPPSCVLCLKQGHPANYRGCPRAPRKRPTHPAPRTVGPKTSAPSVPKPAFVPAAVPTVSAWKKPLPYTKAGTQTAPPPPLATRPAPQPLLAPRPAPAFRPPQPSAANDFALVRDFVTAVNFDRLRSFADAIRRSTTPEQRLAAAFDHMDV

Summary

Uniprot
ProteinModelPortal

Ontologies

Topology

Length:
534
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00018
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00137
outside
1  -  534
 
 

Population Genetic Test Statistics

Pi
234.913183
Theta
7.376836
Tajima's D
3.69069
CLR
24.896548
CSRT
0.99600019999
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号