SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07997  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA001011
Annotation
PREDICTED:_ER_degradation-enhancing_alpha-mannosidase-like_protein_2_isoform_X2_[Bombyx_mori]
Full name
alpha-1,2-Mannosidase      
Location in the cell
Cytoplasmic   Reliability : 1.363 Nuclear   Reliability : 1.379 PlasmaMembrane   Reliability : 1.301
 

Sequence

CDS
ATGGTCAAATTAACCTTCCTGATCAGTATTTCAGTGTTGACTTGTAATTTAATTTTAAGTGTACGAGTATACAAACGTGCAGATATACTTAAACTAAGAGAGGAAGTACGTGAAATGTTTCAACATGCATACGACAGCTATTTAAGATATGCATATCCTTATGACGAATTACGTCCATTGAGCTGCGACGGTGTTGATACCTGGGGCAGTTACTCACTCACCCTCATTGATGCATTGGACACGCTTGCCATTATGGGAAACTATAGTGAATTTAATCGAGTAGTAGATATAGTACTACAGAAAAGACACTTTGATGCAGACATTAACGTTTCAGTGTTTGAGACGAATATTAGAATTGTTGGCGGTTTATTGAGTGCTCATTTACTGTCACATAAAACTGGGATGAAATTAGAACCAGGCTGGCCATGCAATGGTCCTTTACTTCGTTTAGCTGAAGATGTAGCACAGAGACTAATAGCTGCATTTGATACAACTACTGGAATGCCTTATGGAACAATTAACTTGCGATCAGGTGTTCCACCTGGGGAAACTAGTATCACATGCACTGCTGGAGTTGGTACATTTATAATTGAGTTTGGTACTTTGAGTAGACTGACAGGAGATCCATTGTATGAAGAGGTAGCTTATAATGCTTTGAAAGCCTTATACCATCATAGATCACCAATTGGTCTCCTTGGCAACCACATAGATGTGATGACTGGACGCTGGACAGCTCAAGATGCTGGAATTGGTGGTGGAATCGATTCTTATTATGAATATTTGGTTAAAGGTGCCATACTACTAGAGAAGCCAGAGTTAATGTCCATGTTCTTAGAAGCACGTCAATCTATTGAGAAGTACCTGAAAAAAGATGATTGGTTTGTGTGGGCCACTATGTTGCGTGGGCACGTCACCTTACCTGTCTTTCAGTCTCTTGAATCATATTGGCCAGGTCTTTTAAGCCTCATAGGCGAAAGTGACGCAGCGATGCGCATAATTCACAACTACCACAGCGTGTGGCGCCAATATGGATTTACACCTGAAGTGTACAATCTCGGGACGGGTGAGGCGTCTTCGTCACGCGAGAGTTATCCCCTACGACCCGAACTCATAGAGTCAATCATGTATTTGTACCGAGACACCAGAGACCCTATACTGTTGCAAATGGGCGAAGATATTCTGAGGAGCATACAGCATAGTGCCAGGACACCGTGTGGGTATGCAACGATAAAAGATGTTCGTGACCATCGTAAAGAAGATCGCATGGAATCGTTTTTCTTAGCCGAAACCACAAAATACCTGTACCTACTGTTCGATCCGGATAATTTCATTCACAACCCTGGGGTCCGCGGTACTGTCATCGACACACCTAATGGCGAATGCGTGGTCGACCTTGGCGGATACATCTTCAATACAGAAGCACATCCGATTGACCCTAACATGCTGTATTGCTGCCATGAAGCTAGACAAGGTATAAATATCAGCGAGGTTTACAGTATATACCAAATTTTGGAAGAAGAAGATAATATAAAATTTATGACTATGATAGAAGCGAACACCAATGAAACTAAGATCACTCAATCGAACAACAACAATAATGAGAGTGCAATAGAAAATAAAACAATTGACCACACAGAACCGAAGGAAAGATCAGATGAAAACGAGCCTGAACAAAATCAAGTATTGATAAAAACTGAATCGAGAACCGGATACGTCAACCTCGACGGAACGGAAAGGGAGAACGCAAACGAATCAAACCTCAGTGATCTTGTTAAAGAGACGATCAATAAATATTACAACGACACTATAAATGCCGAAACACAAGAAAATGTTAAACATTCAGCCGAAGAACCAACGGCAGGATCGTCGCAAACCGTTGAAGTGGACGACATAATCGTGCCAGAGAAATCGGAGGTGCAACTGCCAAGCGTCACGAAAACGAAAGAAGTAATGAACATGCTGCCAAAAGTTATACAAGACTTTTTGAACAGCGATTGGAAATCGAAACCGAAATGCGAACCGCAGAAGATGTTAGAAAGGATACGTAGAGAACAGAAGTATCCAGATCACCCGGATGTATATAAGTACGAGTTATTATTGACGCCGGCTCCGTCGTTTCTACAAAGAATATCGTTGGCCGGAGAGTTCTTAAATAAGAAGCAACTGGATAAAGAAGATTCACATAAATCAACGCTTGCTTGTAAAATTATTGAAACGGCAAAGGCCCCAAAAGATTTTGTTGTAAAATTTTTGCCACGCGAAATAGATGTGCTCGTGCGCTTGAATCATCCGCATCTGATTCACGTGCATAGCATATTTCAGAGGAAAACAAAATACTATATTTTCATGAGGTACACGGAAAATGGTGATTTACTGAGTTATATACTAAAAAACGGGTGCGTGTCTGAAAATCAAGCTCGCGTCTGGACTCGACAACTTGCATTGGGACTACAATACTTGCACGAGTTAGAAATCGCTCACAGAGACATCAAATGCGAGAACGTACTGTTGACGGCGAATTTTAACGTGAAATTATCTGATTTTGGCTTTTCCCGTTTCTGTGTTGAAAGCGACAATCAGCCTGTCTTAAGCGAAACTTATTGCGGTTCTATGTCATACGCTGCACCAGAAATACTACGCGGAAAACCGTATTGCCCGAAGCCAACGGATTTATGGTCCTTAGGCGTCGTACTATTTGTAATGCTGAACAAATCAATGCCATTTGACGACACGCGTATGAGAAAACTTTATGAACAGCAAATGGGAAAGAAATATCGCTTTAGATCGCGCGTAGCTAGTATACTCTCGCTCGAATGTAAGACTGTTGTAAAGCATTTGTTAGAACCGGATCCAGGACTCCGACATTCCGCTACCAATGTTCTCGACTCTGAATGGATTGCTATGGATAGTAGATTAACCAGTAAGTATAGAAATATATTAAATACTAGCTGA
Protein
MVKLTFLISISVLTCNLILSVRVYKRADILKLREEVREMFQHAYDSYLRYAYPYDELRPLSCDGVDTWGSYSLTLIDALDTLAIMGNYSEFNRVVDIVLQKRHFDADINVSVFETNIRIVGGLLSAHLLSHKTGMKLEPGWPCNGPLLRLAEDVAQRLIAAFDTTTGMPYGTINLRSGVPPGETSITCTAGVGTFIIEFGTLSRLTGDPLYEEVAYNALKALYHHRSPIGLLGNHIDVMTGRWTAQDAGIGGGIDSYYEYLVKGAILLEKPELMSMFLEARQSIEKYLKKDDWFVWATMLRGHVTLPVFQSLESYWPGLLSLIGESDAAMRIIHNYHSVWRQYGFTPEVYNLGTGEASSSRESYPLRPELIESIMYLYRDTRDPILLQMGEDILRSIQHSARTPCGYATIKDVRDHRKEDRMESFFLAETTKYLYLLFDPDNFIHNPGVRGTVIDTPNGECVVDLGGYIFNTEAHPIDPNMLYCCHEARQGINISEVYSIYQILEEEDNIKFMTMIEANTNETKITQSNNNNNESAIENKTIDHTEPKERSDENEPEQNQVLIKTESRTGYVNLDGTERENANESNLSDLVKETINKYYNDTINAETQENVKHSAEEPTAGSSQTVEVDDIIVPEKSEVQLPSVTKTKEVMNMLPKVIQDFLNSDWKSKPKCEPQKMLERIRREQKYPDHPDVYKYELLLTPAPSFLQRISLAGEFLNKKQLDKEDSHKSTLACKIIETAKAPKDFVVKFLPREIDVLVRLNHPHLIHVHSIFQRKTKYYIFMRYTENGDLLSYILKNGCVSENQARVWTRQLALGLQYLHELEIAHRDIKCENVLLTANFNVKLSDFGFSRFCVESDNQPVLSETYCGSMSYAAPEILRGKPYCPKPTDLWSLGVVLFVMLNKSMPFDDTRMRKLYEQQMGKKYRFRSRVASILSLECKTVVKHLLEPDPGLRHSATNVLDSEWIAMDSRLTSKYRNILNTS

Summary

Similarity
Belongs to the glycosyl hydrolase 47 family.
Feature
chain  alpha-1,2-Mannosidase
EC Number
3.2.1.-
Pfam
PF01532   Glyco_hydro_47
Interpro
IPR012341   6hp_glycosidase-like_sf        + More
IPR036026   Seven-hairpin_glycosidases       
IPR001382   Glyco_hydro_47       
SUPFAM
SSF48225   SSF48225       
Gene 3D
PDB
5KKB     E-value=8.4166e-57,     Score=562

Ontologies

Topology

SignalP
Position:   1 - 20,         Likelihood:  0.634926
 
 
Length:
983
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
7.36507999999997
Exp number, first 60 AAs:
6.54729
Total prob of N-in:
0.30394
outside
1  -  983
 
 

Population Genetic Test Statistics

Pi
160.696083
Theta
170.543261
Tajima's D
0
CLR
32.645811
CSRT
0.367381630918454
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号