SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07995
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.851 Nuclear   Reliability : 2.309
 

Sequence

CDS
ATGCCGCCTCTCGCACGCCCCTCAGGCCAACCACCGGCTTACGATGACGATAACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGATCACACCGAGTTAGTCGACAAGGAGGTCGAGCGCAGAACTTCCCTGCCGCCCTCGGCCGCGTTACCCCCCATTACCACTTCCGAGGTTAAGGATGCGATCGATAACCTGCAACCACGGAAAGCTCCCGGATCCGACGGCATCCGCAACCGCGCGCTTAAATTGTTACCAGCCCAAATAATAACGATATTGGCCACCATTTTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCTGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAAAGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTCGCGTCCAACAAAATATTGATCGACGAGCAGTTTGGGTTCCGCGCCAGACACTTGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAATAGGCGGAAACCCATCCCGACAGGAGTCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGCCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGCATATCAATGATATACTCCGGTCTCCGGAGACCAATCTGGCGCTCTTCGCTGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGACGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGTTGAGCATCCCTCTCCCGTCTAGGCGCGTCGACACCTCCGCCTCCGCCATTCGCCCAAGCACGATGTTCGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGAAGGATGACATTCCGCCCCCATATTAAGACGGTACGCGATCGTGCTGCCTTCATTCTAGGCCGTCTCTACCCGATGATATGCAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCACACGCCCAGTCATGACTTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCACACACTTAAAATCCTTCCAAATTATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGATCTGGACTTAGAGTCCATCATTAAGTATCTATACAGTCGGCGTCGAAGCGCCACTTCGATAAAGCGGCATGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTTCCGATCCACTAA
Protein
MPPLARPSGQPPAYDDDNKAELLADALQEQCTTSTQHADPDHTELVDKEVERRTSLPPSAALPPITTSEVKDAIDNLQPRKAPGSDGIRNRALKLLPAQIITILATILNAAMTNCIFPAAWKEADVIGIHKPGKPKKETASYRPISLLPAIGKLYERLLRKRLWDFVASNKILIDEQFGFRARHLCVHQVHRLTEHILLGLNRRKPIPTGVLFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLHINDILRSPETNLALFADDTAIYYSCRKKTLLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPSRRVDTSASAIRPSTMFDQPIPWAPKVKYLGVTLDRRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCTRPVMTYASVVFAHAARTHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESIIKYLYSRRRSATSIKRHDTRTLSSWPPVTTFPILRTEWKAVDVAQNTSSRILPIH

Summary

EMBL
AB018558    BAA76304.1    AB055391    BAB21761.1    U07847    AAA17752.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    KQ459259    KPJ02068.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    GALX01005359    JAB63107.1    GGMR01019198    MBY31817.1    ABLF02014862    ABLF02014866    ABLF02061908    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02003961    ABLF02059872    GGMR01003407    MBY16026.1    GALX01005299    JAB63167.1    ABLF02042518    ABLF02057746    KK117880    KFM71667.1    ABLF02008933    GGMS01004685    MBY73888.1    GFTR01008038    JAW08388.1    ABLF02033757    RPOV01000134    RPJ78669.1    GBBI01004395    JAC14317.1    GBBI01004571    JAC14141.1    GGMS01008766    MBY77969.1    S59870    AAB26437.2    GGMS01000737    MBY69940.1    JXUM01155316    KQ572171    KXJ68070.1    GEZM01038405    JAV81653.1    GGMR01016114    MBY28733.1    GFXV01007093    MBW18898.1    GFTR01008262    JAW08164.1    GGMR01018716    MBY31335.1    NEVH01006736    PNF36716.1    GGMS01002992    MBY72195.1    NEVH01003017    PNF40781.1    GBBI01001646    JAC17066.1    NEVH01010546    PNF32261.1    NEVH01020071    PNF21969.1    NEVH01023962    PNF17612.1    NEVH01018383    PNF23463.1    NEVH01007443    PNF35684.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    ABLF02008463    NEVH01005938    PNF38077.1    NEVH01001355    PNF42855.1    GEZM01074951    JAV64378.1    NEVH01000280    PNF43672.1    GGMS01006359    MBY75562.1    NEVH01019964    PNF22161.1    NEVH01007838    PNF34986.1    NEVH01006754    PNF36554.1    GFTR01008279    JAW08147.1    NEVH01023961    PNF17613.1    NEVH01014858    PNF27387.1    NEVH01002716    PNF41415.1    KK113014    KFM59099.1    GGMR01012305    MBY24924.1    NEVH01020940    PNF20481.1    NEVH01011985    PNF31054.1    JXUM01014072    KQ560393    KXJ82651.1    GGMR01000676    MBY13295.1    GGFJ01002256    MBW51397.1    ABLF02008153    ABLF02008462    ABLF02008464    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GGFJ01002257    MBW51398.1    ABLF02024246    NEVH01006721    PNF37225.1    NEVH01019376    PNF22596.1    GGMS01002955    MBY72158.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    GGMS01012005    MBY81208.1    NEVH01019080    PNF22876.1    NEVH01026154    PNF14491.1    GGFJ01001842    MBW50983.1    AF456125    AAL57609.1    GGFJ01001844    MBW50985.1    GGFJ01001843    MBW50984.1    NEVH01026386    PNF14434.1    AY180919    AAN87272.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    NEVH01017559    PNF23833.1    GFXV01006424    MBW18229.1    GEZM01053022    JAV74219.1    LBMM01014395    KMQ85192.1    JXUM01241784    KQ635293    KXJ62492.1    GGMS01017914    MBY87117.1    NWSH01000032    PCG80497.1    LBMM01010106    KMQ87671.1    NEVH01007578    PNF35646.1    NEVH01020963    PNF20308.1    GFTR01008256    JAW08170.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF10551   MULE
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.00881562,     Score=93

Ontologies

Topology

Length:
554
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.24824000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.04433
outside
1  -  554
 
 

Population Genetic Test Statistics

Pi
1.231247
Theta
0.964526
Tajima's D
0.138761
CLR
135.10982
CSRT
0.48117594120294
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号