SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07982
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.819
 

Sequence

CDS
ATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCAGTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGATACCGTCGAATCCATAAACATCTTCACTGATCACGTCTCGACGGCGATCATAAGATCCTCGAAACAAGTCGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGATCTTAGGGACCTCGTTAGAATTAGAAACGCGGCAATCCGGGCCTACGATCGATATCCCACGGATTCAAACCGGACTCGGATGCGTCGCTTACAGCGGGAGGTCAGATCCCGCTTAAGCGACGCCCGAAACGAAAACTGGGATAGTTATTTAGAAGAACTCGCGCCCACTCACCAAGCATACTGGCAACTAGCTAGGACCCTCAAGTCCGAAACTATAGCCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAATCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTCAAGGAGGCGATCGATAGCCTGCAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAACTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATATTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAATAAAATTCTTATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATGGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGTATATCAACGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATTAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCTCTCCCGACTAGGCGCGTCAACACCCCCGCCCCCGCCGTTCGCCCAATCACGATGTTCGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATCAAGACGGTACGCGATCGTGCCGCCTTTATCCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCATACACTTAAAATCCTTTCAAATCATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAATGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTGCAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATCCACTAACGGTGCTTTTAGGTACTTCAAGTACCGGTCACCGTTCTCGTCGAACCCGTCGCTTGCGACGAAGGGCTCGACGAGTAAATTAA
Protein
MSELDSDHRPVVMQLGRPVNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESINIFTDHVSTAIIRSSKQVDVEDCFHRIRLSPDLRDLVRIRNAAIRAYDRYPTDSNRTRMRRLQREVRSRLSDARNENWDSYLEELAPTHQAYWQLARTLKSETIATMPPLVRPSGQSPAYDDDDKAELLADALQEQCTTSTQHADPEHTEFVDREVERRASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYGVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNTPAPAVRPITMFDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARIHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLGTSSTGHRSRRTRRLRRRARRVN

Summary

EMBL
AB018558    BAA76304.1    U07847    AAA17752.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    GALX01005359    JAB63107.1    ABLF02029306    ABLF02029314    ABLF02060138    GGMR01019198    MBY31817.1    S59870    AAB26437.2    GGMS01006359    MBY75562.1    GFTR01008038    JAW08388.1    GBBI01004395    JAC14317.1    GBBI01004571    JAC14141.1    RPOV01000134    RPJ78669.1    ABLF02042518    ABLF02057746    NEVH01006736    PNF36716.1    GGMR01018716    MBY31335.1    GGFJ01002256    MBW51397.1    GGFJ01002257    MBW51398.1    GGFJ01001844    MBW50985.1    GGFJ01001842    MBW50983.1    GGFJ01001843    MBW50984.1    GFXV01007093    MBW18898.1    GGMS01002992    MBY72195.1    GGMS01002955    MBY72158.1    GEZM01053022    JAV74219.1    ABLF02033757    GGMR01003407    MBY16026.1    GGMS01000737    MBY69940.1    NEVH01006721    PNF37225.1    GBBI01001646    JAC17066.1    GGFL01005012    MBW69190.1    GGFL01004957    MBW69135.1    NEVH01026386    PNF14434.1    ABLF02024246    NEVH01020940    PNF20481.1    GFTR01008271    JAW08155.1    JRES01000644    KNC29657.1    ABLF02008463    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    NEVH01019964    PNF22161.1    NEVH01007838    PNF34986.1    ABLF02034467    NEVH01006754    PNF36554.1    NEVH01014858    PNF27387.1    NEVH01002716    PNF41415.1    GEZM01084969    JAV60363.1    KK119692    KFM76444.1    ABLF02008153    ABLF02008462    ABLF02008464    NEVH01011985    PNF31054.1    GFDF01007661    JAV06423.1    GGFJ01001858    MBW50999.1    GEDC01000337    JAS36961.1    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    GGMR01012305    MBY24924.1    AF456125    AAL57609.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    AY180919    AAN87272.1    GGFJ01001857    MBW50998.1    KQ973363    EFA13335.2    GFTR01008262    JAW08164.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    GGMR01000676    MBY13295.1    GFTR01008251    JAW08175.1    NEVH01005938    PNF38077.1    NEVH01000269    PNF43694.1    NEVH01016302    PNF25823.1    NEVH01003017    PNF40781.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01018383    PNF23463.1    GGMR01006408    MBY19027.1    NEVH01010546    PNF32261.1    NEVH01007443    PNF35684.1    NEVH01021205    PNF19912.1    NEVH01022639    PNF18527.1    NEVH01020071    PNF21969.1    GBYB01008290    JAG78057.1    NEVH01023962    PNF17612.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.00151431,     Score=101

Ontologies

Topology

Length:
750
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.763500000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00680
outside
1  -  750
 
 

Population Genetic Test Statistics

Pi
1.804676
Theta
4.768189
Tajima's D
0
CLR
0.000001
CSRT
0.384330783460827
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号