SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07979
Pre Gene Modal
BGIBMGA001004
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_cytochrome_P450_4g15-like_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.001 Mitochondrial   Reliability : 1.005 Nuclear   Reliability : 1.234 PlasmaMembrane   Reliability : 1.089
 

Sequence

CDS
ATGACGCTAAATATCCATGTGCAGGAGGAAAATCTCACACAAAGGCATCAGACAAGTGCCCCTGTAATTAATAGTGAAATGACGAGCTTGGTGGATGAGACCGAGGGATATCACGTTAATTCTCGCGTGATATTTTATCCTCTACTTGGACTTACCACAGCAATATGGATTCTATACAGATGGCAACAGAACTCACATATGCACAAACTTGCTGAATTGTTACCTGGACCGGCATCAATTCCGATTTTCGGAAATGCTTTGACTCTCATGAGGAAAAATCCCCACGAATTAGTCAACCTCGCTCTGGGCTATGCGCAAACATTTGGCAACGTCATCCGCGTTTGGTTGGGCTCCAAGTTGATCGTTTTTCTAGTTGACGCTGATGATATTGAAATAATCCTTAACAGCCATGTCCATATTGATAAAGCTACCGAGTACAGATTCTTTAAGCCATGGCTTGGTGAAGGACTTCTTATCAGTTCAGGTCCAAAATGGCGTTCACACAGAAAAATGATCGCTCCGACATTTCATATAAACATTCTTAAGTCATTTGTTGGAATCTTCAACCAAAATAGTAACAACGTGGTAGAGAAGTTGAAATCTGAAGTCGGAAAAACATTTGACGTACATGATTACATGAGTGGTACCACAGTTGATATTTTATTAGAAACGGCAATGGGAATTTCAAGAAAGACCCAGGATGAATCAGGCTTTGATTATGCAATGGCTGTGATGAAAATGTGCGATATCATCCACCAGAGACACTACAAATTTTGGATGCGATCCGAGATTGTTTTCAAGTTGACTTCGTTCTTTAAACAACAAACAAAACTTTTGGGCATTATTCACGGACTTACTAACAAAGTCATCAAGAACAAGAAAGAAACGTATCTTGAAAATAAAGCTAAAGGTATCATACCGCCTACACTCGAAGAATTTACTCATCATTCTGGTGAAATTCTAGCAAATAATGCCAAAACACTTTCTGATACCGTTTTCAAAGGATATCGCGATGATCTTGATTTCAATGACGAAAACGATGTTGGTGAAAAGAAACGACTGGCATTTTTGGACCTGATGATCGAATCTTCACAAAATGGAACAAACAAGATATCTGATCATGAAATTAAGGAAGAAGTAGATACAATTATGTTTGAGGGTCACGATACGACGGCAGCTGGTTCCAGTTTCGTTTTATGTCTTTTGGGTATCCATCAAGACGTTCAAGCAAGAGTTTATGACGAGCTTTACCAGATTTTTGGAGATTCCGATAGACCTGCAACATTCGCTGACACCTTAGAAATGAAATATTTGGAAAGAGTGATTCTTGAATCTTTGAGGCTGTATCCACCAGTGCCTGTCATTGCAAGGAAATTAAATCGTGATGTTACTATCTCTACCAAGAACTACGTGATCCCAGCGGGTACAACTGTTGTCATTGGAACGTTCATGTTGCATCGTCAACCGAAATATTACAAAGATCCCGAAGTTTTCAACCCCGATAATTTCCTACCGGAAAACACTCAGAATAGACATTATTACAGCTATATACCATTCAGCGCTGGACCTAGGAGTTGTGTTGGTCGTAAATACGCTTTACTGAAGTTAAAAATCTTACTATCTACGATACTGAGAAATTTCAGAACTATTTCTGAAATACCTGAAAAGGAGTTCAAGCTTCAAGGCGACATCATTTTGAAAAGAGCGGAAGGCTTCCAAATGAAGGTTGAACCTAGAAAACGAGTCCCAACTAACGTCGCCCTACGCTACGATGTGCTCTCCGGCACACCTTACGCAGCGGACCGCACGATGGCAGTTGTAGGATGCGTGTCCGAAGGCCTGGCAGCGATGACACTGCGCAGGCCCTCGGGTTGGACGCCATCCTTCAATCGTCACCCCCGGCAGGTACAACAGTTCGTTGACTGCGTACAAGCGGGCGAGGTCGTCCTTCGAGAGGTGGTCCAGGGCTACGTGAAACACGCAGCCCGGACGCCCTCTCTGGGACCTGATGCACCTGGCATATCGAGCCGGGAATCCCAGCTCCTTGAGGGCATTGACTACTTCTGCCTCGTCGGTGTCGGCAGGGAGGCCCCGGACCGCCACCTTAGAAGGCATCTCCTCCGCCAGGGCATAACAGTACCATTTAATGGTACCATCCCTGGCAGAGGCCTCCGACAGTTATTCAAGTTCATAAAGTTCATGCACAACTACAGGACAGCCGTCGGAGCACCATGGTTCTTCAGGAACGTGGATCTCAATGATGACCTGAAACATGACTCAGTCAGTAAGTATCTACAGACGTCATCATTGCGCCACTTTGAGAAGACGGCACCACATGATAACCCGCTTGTCGTAGCCGCTGGAAACTACATACCCGATCCTGTAGACCGAATGACAAGTGCCCCTGTAACTGATAGTGAAATGACGAGCTTGGTGGATGAGACCGAGGGATATCACGTTAATTCTCGCGTGATATTTTATCCTCTACTTGGACTTACCACAGCAATATGGATTCTATACAGATGGCAACAGAACTCACATATGCACAAACTTGCTGAATTGTTACCTGGACCGGCACCAATTCCGATTTTCGGAAATGCTTTGACTCTCATGAGGAAAAGTCCCCACGAATTAGTCAACCTCGCTCTGGGCTATGCGCAAACATTTGGCAACGTCGTCCGCGTTTGGTTGGGCTCCAAGTTGATCGTTTTTCTAGCTGACGCTGATGATATTGAAATAATCCTTAACAGCCATGTCCATATTGATAAAGCTACCGAGTACAAGTTCTTTAAGCCATGGCTTGGTGAAGGACTTCTTATCAGCTCAGGTCCAAAATGGCGTTCACACAGAAAAATGATCGCTCCCACATTTCATATAAACATTCTTAAGTCATTTGTTGGAATCTTCAACCAAAATAGTAACAACGTGGTAGAGAAGTTGAAATCTGAAGTCGGAAAAACATTTGACGTACATGATTACATGAGTGGTACCACAGTTGATATTTTATTAGAAACGGCAATGGGAATTTCAAGAAAGACTCAGGATGAATCAGGCTTTGATTATGCAATGGCTGTGATGAAAATGTGCGATATCATCCACCAGAGGCACTACAAATTTTGGATGCGATCCGAGATTGTTTTCAAGTTGACTTCGTTCTTTAAACAACAAACAAAACTTTTGGGCATTATTCACGGACTCACTAACAAAGTCATCAAGAACAAGAAAGAAACGTACCTTGAAAATAAAGCTAAAGGTATCATACCGCCTACACTTGAAGAATTGACTCATCATTCTGGTGAAATTCTAGCAAATAATGCCAAAACACTTTCTGATACCGTTTTCAAAGGATATCGCGATGATCTTGATTTCAATGACGAAAACGATGTTGGTGAAAAGAAACGACTGGCATTTTTGGACCTGATGATCGAATCTTCACAAAATGGAACAAACAAGATATCTGATCATGAAATTAAGGAAGAAGTAGATACAATTATGTTTGAGGGTCACGATACGACGGCAGCAGGTTCCAGTTTCGTTTTATGTCTTTTGGGCATCCATCAAGACGTTCAAGCAAGAGTTTATGACGAGCTTTACCAGATTTTTGGAGATTCCGATAGACCTGCAACATTCGCCGACACCTTAGAAATGAAATATTTGGAAAGAGTGATTCTTGAATCTTTGAGGCTGTATCCACCAGTGCCTGTCATTGCAAGGAAATTAAATCGTGATGTTACTATCTCTACCAAGAACTACGTAATCCCAGCGGGTACAACTGTTGTCATTGGAACGTTCAAGTTGCATCGTCAACCGAAATATTATAAAGACCCTGAAGTTTTCAACCCCGATAATTTCCTACCGGAAAACACTCAGAACAGACATTATTACAGCTATATACCATTCAGTGCTGGACCTAGGAGTTGTGTTGGTCGTAAATACGCTTTATTGAAGTTAAAAATCTTACTATCTACGATACTGAGAAATTTCAGAACTATTTCTGAGATACCTGAAAAGGAGTTCAAACTTCAAGGCGACATCATTTTGAAAAGAGCGGAAGGCTTCCAAATGAAGGTTGAACCTAGAAAACGAGTCCCAACTAACGTCGCCCGTTAA
Protein
MTLNIHVQEENLTQRHQTSAPVINSEMTSLVDETEGYHVNSRVIFYPLLGLTTAIWILYRWQQNSHMHKLAELLPGPASIPIFGNALTLMRKNPHELVNLALGYAQTFGNVIRVWLGSKLIVFLVDADDIEIILNSHVHIDKATEYRFFKPWLGEGLLISSGPKWRSHRKMIAPTFHINILKSFVGIFNQNSNNVVEKLKSEVGKTFDVHDYMSGTTVDILLETAMGISRKTQDESGFDYAMAVMKMCDIIHQRHYKFWMRSEIVFKLTSFFKQQTKLLGIIHGLTNKVIKNKKETYLENKAKGIIPPTLEEFTHHSGEILANNAKTLSDTVFKGYRDDLDFNDENDVGEKKRLAFLDLMIESSQNGTNKISDHEIKEEVDTIMFEGHDTTAAGSSFVLCLLGIHQDVQARVYDELYQIFGDSDRPATFADTLEMKYLERVILESLRLYPPVPVIARKLNRDVTISTKNYVIPAGTTVVIGTFMLHRQPKYYKDPEVFNPDNFLPENTQNRHYYSYIPFSAGPRSCVGRKYALLKLKILLSTILRNFRTISEIPEKEFKLQGDIILKRAEGFQMKVEPRKRVPTNVALRYDVLSGTPYAADRTMAVVGCVSEGLAAMTLRRPSGWTPSFNRHPRQVQQFVDCVQAGEVVLREVVQGYVKHAARTPSLGPDAPGISSRESQLLEGIDYFCLVGVGREAPDRHLRRHLLRQGITVPFNGTIPGRGLRQLFKFIKFMHNYRTAVGAPWFFRNVDLNDDLKHDSVSKYLQTSSLRHFEKTAPHDNPLVVAAGNYIPDPVDRMTSAPVTDSEMTSLVDETEGYHVNSRVIFYPLLGLTTAIWILYRWQQNSHMHKLAELLPGPAPIPIFGNALTLMRKSPHELVNLALGYAQTFGNVVRVWLGSKLIVFLADADDIEIILNSHVHIDKATEYKFFKPWLGEGLLISSGPKWRSHRKMIAPTFHINILKSFVGIFNQNSNNVVEKLKSEVGKTFDVHDYMSGTTVDILLETAMGISRKTQDESGFDYAMAVMKMCDIIHQRHYKFWMRSEIVFKLTSFFKQQTKLLGIIHGLTNKVIKNKKETYLENKAKGIIPPTLEELTHHSGEILANNAKTLSDTVFKGYRDDLDFNDENDVGEKKRLAFLDLMIESSQNGTNKISDHEIKEEVDTIMFEGHDTTAAGSSFVLCLLGIHQDVQARVYDELYQIFGDSDRPATFADTLEMKYLERVILESLRLYPPVPVIARKLNRDVTISTKNYVIPAGTTVVIGTFKLHRQPKYYKDPEVFNPDNFLPENTQNRHYYSYIPFSAGPRSCVGRKYALLKLKILLSTILRNFRTISEIPEKEFKLQGDIILKRAEGFQMKVEPRKRVPTNVAR

Summary

Uniprot
ProteinModelPortal
PDB
6C94     E-value=9.08144e-60,     Score=589

Ontologies

Topology

Length:
1369
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
25.3559299999999
Exp number, first 60 AAs:
14.1031
Total prob of N-in:
0.37679
POSSIBLE N-term signal
sequence
outside
1  -  1369
 
 

Population Genetic Test Statistics

Pi
163.800758
Theta
154.084745
Tajima's D
0.529392
CLR
0.42513
CSRT
0.515174241287936
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号