SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07966
Pre Gene Modal
BGIBMGA013783
Annotation
AF461149_1_transposase_[Bombyx_mori]
Full name
Signal transducer and activator of transcription      
Location in the cell
Mitochondrial   Reliability : 1.931 Nuclear   Reliability : 1.877
 

Sequence

CDS
ATGGGGTTAAGCAGAACCACGGTGAAAAGGGTGTTAAATGAAGACTTAGGGCTTCGGGCATATCGAAGAAAAACAGGACATCGTTTGAATGCTCGTCTAATGGACCTGAGACTGAAGAGATGCCGCGCTTTGTTGAAGCGGTACGACGTCCTGACGAACCTTGTGGAACCTGTTTCTCATACCATGTTCAATAACAGGCACTGGGTATTCCAACAAGATTCGGCGCCAGCTCATAGAGCGAAGAGTACACAAGACTGGCTGGCGGCGCGTGAAATCGACTTCATCCGGCACGAAGACTGGCCCTCCTCCAGTCCAGATTTGAATCCGTTAGATTACAAGATATGGCAACACTTGGAGGAAAAGGCGTGCTCAAAGCCTCATCCCAATTTGGAGTCACTCAAGACATCCTTGATTAAGGCAGCCGCCGATATTGACATGGACCTCGTTCGTGCTGCGATAGACGACTGGCCGCGCAGATTGAAGGCCTGTATTCAAAATCACGGAGGTCATTTTGAATAA
Protein
MGLSRTTVKRVLNEDLGLRAYRRKTGHRLNARLMDLRLKRCRALLKRYDVLTNLVEPVSHTMFNNRHWVFQQDSAPAHRAKSTQDWLAAREIDFIRHEDWPSSSPDLNPLDYKIWQHLEEKACSKPHPNLESLKTSLIKAAADIDMDLVRAAIDDWPRRLKACIQNHGGHFE

Summary

Similarity
Belongs to the transcription factor STAT family.
EMBL
RSAL01000021    RVE52408.1    AF461149    AAN06610.1    AB363028    BAG15927.1    + More
AB473770    BAH20555.1    AB363006    AB363010    AB363014    BAG15923.1    BAG15924.1    AB363018    BAG15926.1    RSAL01000063    RVE49524.1    RSAL01000140    RVE46091.1    RSAL01000131    RVE46422.1    RSAL01000022    RVE52367.1    RSAL01000470    RVE41612.1    RSAL01000200    RVE44486.1    U47917    AAB47739.1    LNIX01000030    OXA41211.1    RSAL01000016    RVE53060.1    RSAL01000133    RVE46339.1    UYSL01022144    VDL79905.1    PDUG01000005    PIC23776.1    JARK01001601    EYB87313.1    DS268420    EFO87874.1    JOJR01000015    RCN51257.1    JARK01001658    EYB84158.1    JARK01001337    EYC34439.1    DS268747    EFP00909.1    PIC29926.1    UYSL01019905    VDL71189.1    PDUG01000001    PIC51673.1    JOJR01000583    RCN36166.1    PDUG01000006    PIC20538.1    DS268612    EFO94085.1    KN729202    KIH62598.1    DS268433    EFO97645.1    CAVP010058755    CDL95145.1    UYSL01009772    VDL68385.1    JARK01001411    EYC06502.1    PDUG01000012    PIC13506.1    UZAH01001595    VDO19836.1    UZAH01026445    VDO80847.1    DS268565    EFO90304.1    UZAH01031030    VDP13493.1    DS268492    EFP11689.1    JARK01001418    EYC05389.1    KN728435    KIH63782.1    EFP11674.1    JARK01001471    EYB97976.1    DS268539    EFO88027.1    DS268428    EFO94379.1    DS268466    EFP06959.1    DS268508    EFO83264.1    DS268673    EFO98001.1    DS268421    EFO88618.1    UYSL01019770    VDL69590.1    DS268606    EFO93488.1    DS268679    EFO98285.1    UYSL01021399    VDL78127.1    DS268525    EFO85497.1    PDUG01000004    PIC32571.1    HE601413    CAS00486.1   
Pfam
PF16095   COR        + More
PF00069   Pkinase
PF01017   STAT_alpha
PF02864   STAT_bind
PF00017   SH2
PF02865   STAT_int
PF13358   DDE_3
PF00292   PAX
PF10320   7TM_GPCR_Srsx
Interpro
IPR009057   Homeobox-like_sf        + More
IPR032171   COR       
IPR020859   ROC_dom       
IPR000719   Prot_kinase_dom       
IPR011047   Quinoprotein_ADH-like_supfam       
IPR011009   Kinase-like_dom_sf       
IPR008271   Ser/Thr_kinase_AS       
IPR027417   P-loop_NTPase       
IPR012345   STAT_TF_DNA-bd_N       
IPR008967   p53-like_TF_DNA-bd       
IPR013799   STAT_TF_prot_interaction       
IPR013800   STAT_TF_alpha       
IPR013801   STAT_TF_DNA-bd       
IPR000980   SH2       
IPR015988   STAT_TF_coiled-coil       
IPR001217   STAT       
IPR036535   STAT_N_sf       
IPR036860   SH2_dom_sf       
IPR038717   Tc1-like_DDE_dom       
IPR001523   Paired_dom       
IPR036388   WH-like_DNA-bd_sf       
IPR036906   ATPase_V1_fsu_sf       
IPR017452   GPCR_Rhodpsn_7TM       
IPR000276   GPCR_Rhodpsn       
IPR019424   7TM_GPCR_Srsx       
SUPFAM
SSF46689   SSF46689        + More
SSF56112   SSF56112       
SSF52540   SSF52540       
SSF50998   SSF50998       
SSF48092   SSF48092       
SSF47655   SSF47655       
SSF49417   SSF49417       
SSF55550   SSF55550       
PDB
5CR4     E-value=9.49362e-09,     Score=138

Ontologies

Topology

Subcellular location
Cytoplasm  
Nucleus  
Length:
172
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00175
Exp number, first 60 AAs:
0.0014
Total prob of N-in:
0.29714
outside
1  -  172
 
 

Population Genetic Test Statistics

Pi
68.023699
Theta
52.015828
Tajima's D
0.378183
CLR
0
CSRT
0.47797610119494
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号