SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07943  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA001162
Annotation
cytochrome_P450_CYP4G25_[Bombyx_mori]
Full name
Cytochrome P450 4g15      
Alternative Name
CYPIVG15
Location in the cell
Mitochondrial   Reliability : 1.1 Nuclear   Reliability : 1.45
 

Sequence

CDS
ATGAGCTATACAAACGCAGAAAATGTAGTGCCTACAAGCACGTTTTCTGCGATCAACCTCTTCTATGTGTTACTTGTGCCGGCCGTAATCCTCTGGTACGCCTACTGGCGAATGTCAAGGCGGCGGTTGTATGAGCTTGCTGACAAACTAAATGGGCCTCCAGGACTTCCGTTACTCGGGAACGCCCTGGAATTCGTCGGTGGATCTGCTGACATCTTCAGAAACATAGTTCAGAAAAGCGCTGACTACGATCACGAATCCGTCGTTAAGATCTGGATAGGACCTCGTCTCCTCGTCTTTCTGTACGATCCTCGCGACGTGGAAGTCATCCTGAGTAGTCACGTTTACATCGATAAAGCTGAGGAATACCGTTTCTTCAAACCATGGCTCGGAAACGGTCTTCTTATCAGTACTGGTCAAAAATGGAGGTCTCATCGTAAACTTATCGCCCCCACATTCCATCTGAACGTTTTGAAGAGTTTCATAGACTTATTCAACGCCAACTCAAGAGCTGTTGTGGACAAACTTAAAAAGGAAGCTAGTAATTTTGATTGCCATGACTACATGAGCGAGTGCACGGTTGAAATTTTACTGGAAACTGCTATGGGTGTGAGCAAGAGTACACAAGATCAAAGCGGATTCGAATATGCTATGGCCGTTATGAAAATGTGCGATATACTTCACTTGAGACACACAAAGATTTGGCTGCGACCGGATTTGTTATTTAAATTTACAGATTACGCTAAAAACCAAACCAAGCTCCTTGATATAATTCATGGCTTGACTAAAAAGGTAATAAAGAGGAAGAAAGAAGAATTCGCATCTGGTAAGAAGCCGTCCAATTTGAATGAAACTGCCACCACAAGCGAGCCGTCTACAGGGAAATTGACTTCAGTGGAAGGACTTTCTTTCGGCCAATCATCCGGTCTCAAGGATGACTTAGACGTTGACGATGATGTCGGACAAAAGAAACGTTTGGCCTTCCTTGATCTGTTGCTGGAGAGTTCACAAAGTGGTGTGGCCATTTCCGATGAGGAAATCAAAGAACAAGTAGACACTATTATGTTTGAGGGTCACGACACAACAGCTGCCGGAAGTAGTTTCTTCCTATCAATGATGGGTATTCATCAAGATATACAAGACAAAGTCATTGAAGAACTGGACCAGATATTTGGTGACTCAGATCGCCCAGTTACGTTCCAAGACACTTTGGAGATGAAGTACTTGGAAAGGTGCCTTATGGAAACTCTGAGATTATACCCGCCAGTGCCGATCATCGCTCGGCAAGTTAATCAAGAAATCACCTTACCATCCAATGGAAAGAAAATCCCAGCCGGAACAACATTGGTGATAGCTACATATAAACTTCATCGCCGCCCTGACGTTTACCCAAATCCAAACAAATTTGACCCTGACAACTTCCTTCCGGAACGTTCCGCCAACAGACATTATTATGCGTTCGTGCCTTTTTCAGCTGGACCAAGAAGTTGCGTTGGACGTAAATACGCAATGCTCAAATTGAAGGTGATCCTTTCTACAATTTTGAGAAATTTCCGAGTAATATCAGATCTTAAAGAATCAGATTTCAAACTGCAAGCGGACATCATTCTGAAACGGGCCGAAGGATTCCAAGTACGCTTACAGCCCCGCAAGAGAATGGCCAAGGCTTAA
Protein
MSYTNAENVVPTSTFSAINLFYVLLVPAVILWYAYWRMSRRRLYELADKLNGPPGLPLLGNALEFVGGSADIFRNIVQKSADYDHESVVKIWIGPRLLVFLYDPRDVEVILSSHVYIDKAEEYRFFKPWLGNGLLISTGQKWRSHRKLIAPTFHLNVLKSFIDLFNANSRAVVDKLKKEASNFDCHDYMSECTVEILLETAMGVSKSTQDQSGFEYAMAVMKMCDILHLRHTKIWLRPDLLFKFTDYAKNQTKLLDIIHGLTKKVIKRKKEEFASGKKPSNLNETATTSEPSTGKLTSVEGLSFGQSSGLKDDLDVDDDVGQKKRLAFLDLLLESSQSGVAISDEEIKEQVDTIMFEGHDTTAAGSSFFLSMMGIHQDIQDKVIEELDQIFGDSDRPVTFQDTLEMKYLERCLMETLRLYPPVPIIARQVNQEITLPSNGKKIPAGTTLVIATYKLHRRPDVYPNPNKFDPDNFLPERSANRHYYAFVPFSAGPRSCVGRKYAMLKLKVILSTILRNFRVISDLKESDFKLQADIILKRAEGFQVRLQPRKRMAKA

Summary

Description
Probably involved in steroid hormones biosynthesis.
Cofactor
heme
Similarity
Belongs to the cytochrome P450 family.
Keywords
Complete proteome   Endoplasmic reticulum   Heme   Iron   Membrane   Metal-binding   Microsome   Monooxygenase   Oxidoreductase   Reference proteome  
Feature
chain  Cytochrome P450 4g15
EC Number
1.14.-.-
EMBL
BABH01000675    AK289272    BAM73799.1    AK289275    BAM73802.1    AK289276    + More
BAM73803.1    DQ443326    ABF51415.1    AK289271    BAM73798.1    AK289269    BAM73796.1    GU731532    ADE05582.1    GU205081    ACZ97444.1    AB196795    BAD81026.1    KF701159    AHW57329.1    RSAL01000173    RVE45071.1    JX310087    AFP20598.1    KC789746    AGO62001.1    KQ460202    KPJ17172.1    KY304477    AUN86408.1    KQ459299    KPJ01904.1    AK401143    BAM17765.1    MG829854    AXJ21601.1    KP001142    AJN91187.1    NWSH01002335    PCG68501.1    KZ149944    PZC76821.1    KX443460    ASO98035.1    KM016724    AID54876.1    GCVX01000062    JAI18168.1    GQ915319    ACZ97413.1    GAIX01012261    JAA80299.1    KY212034    ARA91598.1    AY390259    AAR26517.1    AGBW02009477    OWR50723.1    JTDY01006357    KOB66075.1    DS232046    EDS33030.1    GFDL01005140    JAV29905.1    CH477291    EAT44585.1    KX609526    ARN17933.1    JXUM01106399    JXUM01106400    KQ565051    KXJ71408.1    GFDL01005132    JAV29913.1    DQ117464    AAZ94273.1    AXCM01006317    GGFM01002297    MBW23048.1    ATLV01015123    KE525003    KFB40088.1    ADTU01011802    GAMD01003352    JAA98238.1    KQ768821    OAD53067.1    GGFM01002300    MBW23051.1    ADMH02001125    ETN64031.1    KQ976396    KYM92870.1    NNAY01001171    OXU24891.1    KP859400    AKZ17710.1    GL888417    EGI61202.1    AAAB01008885    EAL40625.3    EGK97044.1    EGK97045.1    APCN01008038    APCN01008039    KQ981727    KYN37083.1    KQ435720    KOX78679.1    KQ434820    KZC06992.1    KF656702    AHB59619.1    KP001141    AJN91186.1    KQ983211    KYQ46660.1    KQ979973    KYN18382.1    KQ971338    EFA02880.1    CVRI01000019    CRK90412.1    GL448193    EFN85148.1    KQ414614    KOC68891.1    KC243983    AGQ03779.1    DQ244075    ABB36785.1    KC243984    AGQ03780.1    GDJX01021362    JAT46574.1    GL444981    EFN60325.1    KJ702273    AID61427.1    JRES01000290    KNC32693.1    KK107087    QOIP01000001    EZA59842.1    RLU27419.1    GEDC01015940    JAS21358.1    CM000366    EDX17646.1    CH480851    EDW51392.1    GEZM01080918    JAV61994.1    MG840833    AYN79709.1    CH954180    EDV46045.1    GFDF01000604    JAV13480.1    KU833274    ANW46746.1    AE014298    AAN09635.2    AF159624    AY060719    KQ977873    KYM99110.1    MG829857    AXJ21604.1    KA645002    AFP59631.1   
Pfam
PF00067   p450
Interpro
IPR036396   Cyt_P450_sf        + More
IPR002401   Cyt_P450_E_grp-I       
IPR017972   Cyt_P450_CS       
IPR001128   Cyt_P450       
SUPFAM
SSF48264   SSF48264       
Gene 3D
PDB
6C94     E-value=6.60054e-67,     Score=646

Ontologies

Topology

Subcellular location
Endoplasmic reticulum membrane  
Microsome membrane  
Length:
556
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
22.33054
Exp number, first 60 AAs:
22.10303
Total prob of N-in:
0.82018
POSSIBLE N-term signal
sequence
inside
1  -  12
TMhelix
13  -  35
outside
36  -  556
 
 

Population Genetic Test Statistics

Pi
219.221552
Theta
167.849512
Tajima's D
-1.177886
CLR
0.356203
CSRT
0.109844507774611
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28467696 STPVPPSQFQPQIDGEYR 100.00 2e-04
28467696 HYVVVDRDPIAPR 100.00 4e-04
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号