SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07937
Pre Gene Modal
BGIBMGA000981
Annotation
PREDICTED:_uncharacterized_protein_LOC105841932_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.175
 

Sequence

CDS
ATGAAGGATTTTATTATTGCACTCCTAGTGTCTATTTGGATTCATCATGGATTTACTCAGATAGCAACATTTGACGTGAGATTAGGGAACTTATACTTAATGCAACGAGGATTAGGGTCGCCATATGAATTAAGAGTAGCAAAGGGACATGAAGCTCTTTTAAAACTGAACAGAGAGTTGGTAAACCAGCAGTCTTGTTCGGTCACAACACCAAAAGGCGTCACGTTTGATGTTCGACAGCCCCCTCAAAACAGATACGAAAGTTGGAGCGATGGATGCGGTGTGAGAGTCCGTAACATAATTAAAGAAGACGAAGGCAGATGGAGGTTAACTGCTACTAGAGGAAATTATTCTATAACTGGATGGTCTGAAGTGCATGTTCAAGATGAAATACCAGAATACCATCCAACACCAATAGCTCTACAAGACGGGGAAAGGCACGCTCATGTTGATCTCACTACGCTCAACAGCGCCTACTGTTTGGTTGAACAGCCCTTTTCTGATATTTCGTTTGTGCCTGGACACTGCAGCGTGACTTTGGATCGGACCACGAGAGCGGTTCAAGGGAACTGGAATGTTGTCCTTGGTCTGCCAGGACAAGTAGCAGAAGTACAAGCCAACACCAAAGTTGAGGTGGAAGGTGAGTTTCGCTATAAATGTACACAGATGCCAAGGGTACGCCAAAGAAAGACTACGAAAGGTCGGGCAGACTTATCAACGTATAAACAAGCTTATGATGATGTAAAAGCGGGATCGTCGTTAAGAACAACGGCAGAAAAACATGGACTGAACCACTGTTCCCTGTTCCGATATGTACATAAACGAGATGCGGCTGGTAACGACGAAAATCAAGAAATGGGATATAAGGCCCACAATCGGGTGTTTACCCGGGAACAAGAGCTTGAGTTATCTAAATATTTAATCAGATGTGCAGATATATATTTTGGCCTAACTAAAAAGGATGTCATGAAATTGGCATACGAACTAACCGTCAAGTACAACTTATCACGACCTCGGACTTGGGATGACAACGGAATGGCTGGCGAAGAATGGTTTCGCATGTTTATGAAAAGAAATTCTGAACTGTCAGTACGTGCAGCACAAGCCACAAGTCTTTCTAGGGCGACTAGCTTTAATAGGAAAAACGTAGATGCTTTCTACGACAATTTGGCTAATGTTATGGACCGCTACAAATTTGAACCACAAAATATCTATAATGTTGATGAGACTGGCATAACTACTGTGCAAAAACCCGACAGAATTATAGCTAGACGTGGTGCTCGTCAAGTAGGCTCAGTAACTTCGGCGGAGAGGGGTGCTTTAGTTACAGTAGCCATTGCGGTCAATGCCATCGGAAATGCTATTCCTCCGTTCTTTGTCTTTCCGCGAGTACGATACCAAGATCACTTTGTCAGGGATGGGCCAATAGGATCTGCTGGGAGTGCAAATCCTTCTGGCTGGATGCAGGATGAATCATTTATGCATTTCCTGGATCACTTCAGGAAACATACGAATGCTTCTCCTTCGCGTAAAATTTTACTTGTGCTTGATAACCACGCGTCACATATACACATTAACGCACTAGACTTTTGCAAGACGAATGGTATTGTAATGCTATCTTTCCCTCCCCACTGCTCACACAAACTCCAACCACTTGATCGATCTGTATTCGGTCCACTAAAAAAAGCTGTAAATTCGACCTGCGATGGATGGATGCGAAGCCACCCCGGAAAGACAATGACAATATACGACATTCCAGGGATTTTAACTACTGCTATGCCGCTTGCTCTTACACAATCCAATATTCAAGCTGGCTTTCGCACAACTGGGATTGTTCCATTTAATCGACATTTGTTTACTGAGCTCGATTTTGCACCTGCCTTTGTGACAGATAGGCCAAATCCATTAGAAGCAGCTGATGGTCCTATTCAGAATATTAATACACTTGAGGATAAAACGCCACCAACATCACCTTCCATTTTAACCCTCGAACCACAAGAAGAGATGGAGGAGCTTTCTAATGAAGCTCTTCTTGTACAACAACCGACTGAAAATATGCCACAATGTTCACAAGTACTTGATAAAGAACAGGAAAACATTATTGCAAATCCAAAACTTTTGATTATATTACCCGGACATGAAAGTAGTAGTAGCGCTCAGCAAATTTCACCCAAACCCTCTAAAAGTTCTCAATCCATTCCTGTGTTAACAACTCAAACGGGAAGTATCATGACTTTGACTACACCATCTTTATTTTCGCCAGAAGTAATACGACCACTACCAAAAGCTCCTCCAAGGAAATTAACAAATAGGGGCCGAAAAACCAGGAAATCTACTATCTACACAGACACACCTGAAAAAGAAGAGATAAGAAGAGAATATGAAAACAGATTGAAACGAACCAAAGCTAAACAAGTTAAGAAAAGATTAGATGGGGGAAAGACTAAAACAAATGCTAGAAGCAGGGGAAAAATTAAGATGCACCAAGAGTCATCATCATCAGAAGAAGAGGAGTGCTACTGTGTTGTTTGTATGTCAGCATATTCAGAAAGCAGACCCAGGGAAAAATGGATACAATGCACAGTATGTAAAATGTGGGCGCATGAAGAGTGCACACAAGTTGAAAGTTTGGACACGGGATACGTACAAGATACGAATGCTAAGAAGTTACATTTGTACTGCAACATATTGCATACACAGAAGAATATCACATTTTGTCGTTTCCAAAAGATAACGGAACATGTTGGTTATAATATTATGAACGGCTTGAGCGATGGTGCGCACAGTTATTACGGGGACGGTTTCGAGATGCGACACTGTGGTATGACGGTGGAAAATCCAACTGAACAAGTGTTCGGTACGTGGCGGTGTACTGTGGGAGTTCAGGAAAGGGTCGGCACTCAAATACACCAGAGGACACCGATGCAAGCGTTGATTAGGGTTTCCCCATACAATTTAGGTTCAAGAATCATGAATGAAGTTAATGAAGACAGCATTGCGAGTAGAACGATCTTTGTACAAAGGGATATGGGTTTCACAATAACGTGCAGAGCTGAGGTTTCATTGAGCTATTGTTGGTTTCAACATCCGAACGGAACCCAGTACACTCCTGTGCCACGGAGCGATGATTCCGATGACAGTTTATTTTGGTATGCCGGTGAAAGTCTTCAAACTGGCGATTGTGGTATATCGTTTTCTTACGCTACGGATGAAGACTCCGGAGAATGGACTTGTCATATGGGTCCAAGAAGGCAAATGGGAGTCGAACTTACCGATAAATTAGTAGTTCGTGTGACTGGTCCGTTAGCGGCTAGTCAAAAGGAGATCCCTACGGTGATTGATGGGAGTGCTACATTGTTTTGTAAAACGTCGAATGGGAACAGACCGTTGGAATACTGTCGGTTCTTGTCCCCAAAATTTGTTGGCATTAGCATTGATCCGTCTGTTACAAAGGAAAACGCAATACTGGGCAGATACTTTTTTACAACCGGCAGAGATTTAGATTATGGTGATTGTTCTTTGACGATTATATCGGTAACCAATGATGACTTAGGAGAGTGGACATGCGCTGCTCTACTACACGACGAGGCCGCGGAGAGTAGAGACATCATGACACTCTACGTCGAACAAAGAAGATTGGAATGA
Protein
MKDFIIALLVSIWIHHGFTQIATFDVRLGNLYLMQRGLGSPYELRVAKGHEALLKLNRELVNQQSCSVTTPKGVTFDVRQPPQNRYESWSDGCGVRVRNIIKEDEGRWRLTATRGNYSITGWSEVHVQDEIPEYHPTPIALQDGERHAHVDLTTLNSAYCLVEQPFSDISFVPGHCSVTLDRTTRAVQGNWNVVLGLPGQVAEVQANTKVEVEGEFRYKCTQMPRVRQRKTTKGRADLSTYKQAYDDVKAGSSLRTTAEKHGLNHCSLFRYVHKRDAAGNDENQEMGYKAHNRVFTREQELELSKYLIRCADIYFGLTKKDVMKLAYELTVKYNLSRPRTWDDNGMAGEEWFRMFMKRNSELSVRAAQATSLSRATSFNRKNVDAFYDNLANVMDRYKFEPQNIYNVDETGITTVQKPDRIIARRGARQVGSVTSAERGALVTVAIAVNAIGNAIPPFFVFPRVRYQDHFVRDGPIGSAGSANPSGWMQDESFMHFLDHFRKHTNASPSRKILLVLDNHASHIHINALDFCKTNGIVMLSFPPHCSHKLQPLDRSVFGPLKKAVNSTCDGWMRSHPGKTMTIYDIPGILTTAMPLALTQSNIQAGFRTTGIVPFNRHLFTELDFAPAFVTDRPNPLEAADGPIQNINTLEDKTPPTSPSILTLEPQEEMEELSNEALLVQQPTENMPQCSQVLDKEQENIIANPKLLIILPGHESSSSAQQISPKPSKSSQSIPVLTTQTGSIMTLTTPSLFSPEVIRPLPKAPPRKLTNRGRKTRKSTIYTDTPEKEEIRREYENRLKRTKAKQVKKRLDGGKTKTNARSRGKIKMHQESSSSEEEECYCVVCMSAYSESRPREKWIQCTVCKMWAHEECTQVESLDTGYVQDTNAKKLHLYCNILHTQKNITFCRFQKITEHVGYNIMNGLSDGAHSYYGDGFEMRHCGMTVENPTEQVFGTWRCTVGVQERVGTQIHQRTPMQALIRVSPYNLGSRIMNEVNEDSIASRTIFVQRDMGFTITCRAEVSLSYCWFQHPNGTQYTPVPRSDDSDDSLFWYAGESLQTGDCGISFSYATDEDSGEWTCHMGPRRQMGVELTDKLVVRVTGPLAASQKEIPTVIDGSATLFCKTSNGNRPLEYCRFLSPKFVGISIDPSVTKENAILGRYFFTTGRDLDYGDCSLTIISVTNDDLGEWTCAALLHDEAAESRDIMTLYVEQRRLE

Summary

Uniprot
Pfam
PF03184   DDE_1
Interpro
IPR004875   DDE_SF_endonuclease_dom        + More
IPR003599   Ig_sub       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR036179   Ig-like_dom_sf       
SUPFAM
SSF48726   SSF48726        + More
SSF57903   SSF57903       
Gene 3D
ProteinModelPortal
PDB
1F97     E-value=0.0120724,     Score=96

Ontologies

Topology

SignalP
Position:   1 - 19,         Likelihood:  0.837019
 
 
Length:
1214
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
8.13118999999996
Exp number, first 60 AAs:
7.80991
Total prob of N-in:
0.38570
outside
1  -  1214
 
 

Population Genetic Test Statistics

Pi
167.912258
Theta
151.769056
Tajima's D
-1.079177
CLR
50.186271
CSRT
0.124743762811859
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号