SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07920
Pre Gene Modal
BGIBMGA014468
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_uncharacterized_protein_LOC106709759_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 2.37
 

Sequence

CDS
ATGGCACCCGTAATCCCTGAAATAACATTACCCGCGTCTGCAGAGGACATAAACAGTAGGGACACATACCTCGAAACCGTCCGTAAGCTCATATCCTGCATCACAACAGCTGTGACTGAGGGAAAAAGTGTTACCGCAGCTAACAAGCGCCTTATCTGCTCCGCGGCGGAGGAAATTCGTAGGGCGACGAGAGTGTTGGAAACAACACTCGCATCGACACTGACACCACCAACCCCCTCTCCACCTGCCACCAACGAAGGTTTGAAGGAGGAGATTATCGCTTGCGTCAGAGAGGAGTTCAAGCGGCATAGACAACTACCGCCGCTGACCCTTCAATCACAAGTTCGCCCATCGTATGCCCAAGCCGCAGCACCCAACCCCCGGAAACCAGCCCTTACGACCAAACCAACACCCAAAACATATCCAGCTACAAAACCTGCAATTATTGTCTCAGCAAAAACCGAAGTAAAGACGAAACAGGATATTATCGAGGCCTGGAGGCGCAACATCAGCTTCAAAAATTCCGGCTTTGCCCCTAGCAGAGTACAAGCTGTATCAAATAACAAACTAAGAATCGAGTTCGATAACATAGAACAAAGGAACGATACCCTCACTCGTATCACTAACTCCCAGACAATTCACGCCGAACCCGCTCGCAGGCTGCTGCCTATGCTCAATCTCAAGGGAGTCTCCAAAGACGTTCCCGCTGAAGATCTAGTGAGCATAATCAGCAGACAGAACCCGGAACTCACTAACGCAATCAACCAAAAGGAGGACTTGCGGTTTCGTTTCCAGCGCTCCAACAGAAACCCCAACTTATATAACGCCATCCTAATTGCACAGCCAACTGTCTGGCGTAAGTGTATAAGCCTGGGCAGAATCAGTGTGGACCATCAACGTATTCACGTAGAGGAGTTCACACCGTTCCTGCAGTGTCACAAGTGCCTTAGCTTCGGCCACACTAAAAACAAGTGTTCGTCCACCGAACAATACTGTGCACACTGCAGCGCAAATAACGAGGTCAAAAACATCCCCGGAATTAACATTTACCAATTCTCTGACGGCGCGCGTGTCAAGGCCTGCATACTAGCTAAGACAGGTGTCGGCTCAGTCCTCGGCCTATCCCAATACTCTTCGGCAAACCTGTCGGTCATACAGCTAACGGCAGGAAACAAGAAGACGTACATAGCCTCAACGTACATCGAACCCGATGTCGATGCCAACGGCACCATGGAGCGTCTGGAAGTTTTCCTTAAAGACATAGGAGGGGCGAGAGTAATTGTGGGAGGTGACTTCAATGGATGGCACCCATCGTGGGGGAGCGTGAGGGTGAACCCCAGAGGCTCATCACTAGTCGAACTAGCGCACAGCAACGATTTATACATTTGTAACTCAGGAGACACTCCAACCTTCGAAACCATCACTCATGGCCGCAATAGATCATCCATCATCGACCTTACTCTTGCATCCAGCGACCTCTTCAACAGCATCTCTGAATGGCACGTAAATCTTAACACATGCCCCACCTCCCAACACAACGCCATTGAATTCTCACTTAACACCAACGAAAACACAAATAAACACGCAGAAAACACTTCCACATTCCTATACAAGTCGGAACAAGCCAATTGGACAATATTTAGAAACACCCTCCACACTCTTATGGCCAACACAGACATCCTTGATAGGAGCGTTGAAAGCTTAAGCCCAGAGGGACTTGAGTCGCTCCTTCGGGAAGTCACGGACATCCTACACCGGGCCTGTAGGGCATCGATGCGAGTAAAAGCAGGCTCTGGGAATAGACACAAGCCGCCTTGGTGGAACGATCGTCTTCAGGACCTTAAAAACGAGGTAATCAACGTACATCGCAGATTACGTGCGGCCAAGAGACAGAACCTACCATTGGATGACCTCATAGAGCAACAGCAGACGAAAAAAGCCCTATACGCCGATGCCCTACGTGCAGAGTCGACGAGAAGCTTCCGCAGCTTCTGTGAATTACAAACGAAGGAAAATGTATGGTCACTCACCAACAGACTTTTAAAGGAATCCACCCCTAAACGGCCACCAGCTACTCTTAAGACTGGAAATACATTCACCACCTGTGCAAAAGAGACGGCGGAGGCTCTCTTAGAGCACTTTTACCCTGCTGACACTCCAGACACCATAGCACGACATCACCAACTTCGCGCATGCTACGACGCTCCCGTAGACACTGAAAATGACCTACCATTCACCGAGGAGGAGGTCATGGAGTGTCTGCAATACATGAACCCCAAAAAGGCCCCAGGGCTCGATCACATAACAGCTGACATATGCCAACAATTCGCATCCGCTTACCCCCGCTTAATCACCAACATTATGAACCGCTGCCTCACCCTTCAACACTTCCCCGATCAGTGGAAAACTGCGTATGTAAAAATCATCCCGAAGCCCGGTAAAAGCGACCACACATCTCTCACCTCATTCCGACCCATTGGACTCATCCCCGTCCTTGGAAAGCTCCTCGAAAAACTGATCACCATACGGATTATGCATTGGGCATCTGTCACAGGAAGGAGCAGTCAACGACAGTTCGGCTTCAAGGAGCAAACCGGCACGGTCGACGCCATTAACACCCTGATAGACACTATACGAAAAGCCAAACAAGAGAGGTCACAGGTTGTCGCCGTCTCGCTCGACATCAGGGCGGCTTTTGATAACGCCTGGTGGCCGGTCCTATTACACCGCCTTAGAGATATACGATGCCCCAAAAATATCTACGGCCTCATCAAGAGCTACCTCCGAGACAGGCGCGTCGTTCTGGACCACGGAGGAGTTCGCGTCTCCAGAGCCACGTCAAAAGGTTGCGTTCAGGGCTCGGTGTGCGGGCCTGCATTGTGGAACATCATACTTGATGAACTATTGGAGATCCATCTACCATCTGGATGCCACATGCAGGCCTACGCAGACGATGTGGTACTCGTGGTCACCGCCGAAAATGTCAATCGCCTAGAGGAGCTCACCGACACGGTTCTCCAACAGATAGTGAATTGGGGAAAAAGCGTCAAGCTCGAATTCGGGGCCTCCAAAACACAACTGATCGCCTTCACCCCCAAGGCCAGAACTCTTAGGGTGGAGATGGACGGTCAAATCTTAAAAACCTGTAAGGAGATCAAGCTCCTCGGAATAATTTTGGACGAAAAGCTACTCTTTGGCCGCCATGTACAGTACGTCCTGGGAAAAGCCTCGCGAATATTCAACAAACTGTGCTTGTACTCCCGACCAACCTGGGGTGCTCATCCCGAGAACGTGCGCACCATCTATCTCCGAGTCATCGAGCCAATCGTCACCTACGCTGCCGGGGTGTGGGGACACATAGTAAACAAGCGCTACATCAAAAAATCTTTGATGAGCATGCAGCGTGGTTTTGCCCTAAAAGCCATCAGAGGATTCCGCACTATTTCAACCTCCGCTGCTCTGGCTCTCGCACAATTCACCCCTCTAGACCTAAAAATCCGAGAAGTACACCAAATCGAAAAAGTCAGGCTCACTGGGAAAACTGAATTCCTCCCCAATGACATTTCTTATGAGAAACCTGTCCCCGTCAAGGACCTCCTACATCCCGCTAGAAGGCCGACAATCAAACCCATACCCTCCTCTGAACACCGAATTAACTCCGAAATGACGGACAGTACTCTGGTCACTCGCGTATTCACTGACGGAAGTAAGCAGGACGATGGATCAGTTGGAGCCGCATTCGTGCTTTACAGACCCGGCGACACTGAAATATCCGTAACAAAAAAGTACAAATTACACAGTAGCTGCACAGTCTTCCAGGCAGAGCTGTACGCCATCTGGAAAGCCTGTCAGTGGATTGTAAGCGAAAATCATCCCCACACATACATCTTCACCGATTCTCTCTCATCAATATACGCGATAAATAACAGAAGCAACACACACCCCATCATAGTGAACATACACAAACTCATACACGCTAACCACACTACACACAAAATTTTCATAGACTGGGTAAAGGGACACTCGGGTGTCATAGGAAACGAGGAAGCCGATGCGGCTGCCAACAGCGGCGCACGCATGCACAAGGCCCCCGACTACTCGCAGTTCTCAATATCCTACGTGAAACACAAGATTCACACAGAACACCACGCCATCTGGCAAGCCAGATACGAAAGCTCCCCGCAGGGCTCACACACAAAAACACTACTACCAAAACTGAACGACATCAAAGAACTCAACAAATGCACACAAACAAACTTTCAGCTTACACAAATACTCACAGGCCATGGATATCACAAGACATACTTACATCGCTTCAAAATAGCACCAGATGACACCTGCCCCTGCGACGGCACTTCCAGCCAAACTGTAGAACACCTCCTTAAAAACTGCCAAGTGTTCGCTGCGAAAAGGCACAGCCACGAAGAAACGTGCCACGAAGTACAGGTGTCACCATATAATTTACCTGAAATGTTAAAAAAGAAAGCTGCAATCAACTCTTTCACTTCGTTTTGCCAAACAATAATCAACAACATCAAGAAAATAAATGAAAACAATTAG
Protein
MAPVIPEITLPASAEDINSRDTYLETVRKLISCITTAVTEGKSVTAANKRLICSAAEEIRRATRVLETTLASTLTPPTPSPPATNEGLKEEIIACVREEFKRHRQLPPLTLQSQVRPSYAQAAAPNPRKPALTTKPTPKTYPATKPAIIVSAKTEVKTKQDIIEAWRRNISFKNSGFAPSRVQAVSNNKLRIEFDNIEQRNDTLTRITNSQTIHAEPARRLLPMLNLKGVSKDVPAEDLVSIISRQNPELTNAINQKEDLRFRFQRSNRNPNLYNAILIAQPTVWRKCISLGRISVDHQRIHVEEFTPFLQCHKCLSFGHTKNKCSSTEQYCAHCSANNEVKNIPGINIYQFSDGARVKACILAKTGVGSVLGLSQYSSANLSVIQLTAGNKKTYIASTYIEPDVDANGTMERLEVFLKDIGGARVIVGGDFNGWHPSWGSVRVNPRGSSLVELAHSNDLYICNSGDTPTFETITHGRNRSSIIDLTLASSDLFNSISEWHVNLNTCPTSQHNAIEFSLNTNENTNKHAENTSTFLYKSEQANWTIFRNTLHTLMANTDILDRSVESLSPEGLESLLREVTDILHRACRASMRVKAGSGNRHKPPWWNDRLQDLKNEVINVHRRLRAAKRQNLPLDDLIEQQQTKKALYADALRAESTRSFRSFCELQTKENVWSLTNRLLKESTPKRPPATLKTGNTFTTCAKETAEALLEHFYPADTPDTIARHHQLRACYDAPVDTENDLPFTEEEVMECLQYMNPKKAPGLDHITADICQQFASAYPRLITNIMNRCLTLQHFPDQWKTAYVKIIPKPGKSDHTSLTSFRPIGLIPVLGKLLEKLITIRIMHWASVTGRSSQRQFGFKEQTGTVDAINTLIDTIRKAKQERSQVVAVSLDIRAAFDNAWWPVLLHRLRDIRCPKNIYGLIKSYLRDRRVVLDHGGVRVSRATSKGCVQGSVCGPALWNIILDELLEIHLPSGCHMQAYADDVVLVVTAENVNRLEELTDTVLQQIVNWGKSVKLEFGASKTQLIAFTPKARTLRVEMDGQILKTCKEIKLLGIILDEKLLFGRHVQYVLGKASRIFNKLCLYSRPTWGAHPENVRTIYLRVIEPIVTYAAGVWGHIVNKRYIKKSLMSMQRGFALKAIRGFRTISTSAALALAQFTPLDLKIREVHQIEKVRLTGKTEFLPNDISYEKPVPVKDLLHPARRPTIKPIPSSEHRINSEMTDSTLVTRVFTDGSKQDDGSVGAAFVLYRPGDTEISVTKKYKLHSSCTVFQAELYAIWKACQWIVSENHPHTYIFTDSLSSIYAINNRSNTHPIIVNIHKLIHANHTTHKIFIDWVKGHSGVIGNEEADAAANSGARMHKAPDYSQFSISYVKHKIHTEHHAIWQARYESSPQGSHTKTLLPKLNDIKELNKCTQTNFQLTQILTGHGYHKTYLHRFKIAPDDTCPCDGTSSQTVEHLLKNCQVFAAKRHSHEETCHEVQVSPYNLPEMLKKKAAINSFTSFCQTIINNIKKINENN

Summary

Pfam
PF00075   RNase_H        + More
PF00078   RVT_1
PF14529   Exo_endo_phos_2
PF16012   DUF4780
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR012337   RNaseH-like_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR002156   RNaseH_domain       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR013604   7TM_chemorcpt       
IPR031961   DUF4780       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
Gene 3D
PDB
1WDU     E-value=8.36275e-16,     Score=210

Ontologies

Topology

Length:
1519
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.61052
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00003
outside
1  -  1519
 
 

Population Genetic Test Statistics

Pi
233.226927
Theta
17.749699
Tajima's D
0.481843
CLR
13827.414143
CSRT
0.51812409379531
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号