SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07898
Annotation
PREDICTED:_uncharacterized_protein_LOC106720343_[Papilio_machaon]
Location in the cell
Mitochondrial   Reliability : 1.577 Nuclear   Reliability : 1.843
 

Sequence

CDS
ATGACTGTGACACAAAAGGCAGGAAGTGTTGTAGCGTCCGTGTACGACCGTGAGAGTGATGATAGGTATTTGCATTTACGGCCTATTTTCAAAATTCAAGTTCTCGGTAAACAGGGTACTGCACTTATAGATACAGCAGCTAAGCATTGTATTGCTGGTCACACGCTGTATGCTCTCCTTCTGCATAAGGGTCACCCTCTTACTCCCTCCACTAGGCGAGTCAAACTTGCTGATGGGCATGTTCGGAATATGGATGTATTGACAACCATATTACCAGTGAGGTTAGAACACATAGTGATTAATATTCCATTTATAATCTTCCCTGATTCTAATGATAATGAAACTTTACTGGGTATTGATTTTATTAATGCTGCCAAAGTTATTATTGATTTTCATCGTCATGAATGGTATTTTAGTACTGATGCTAAGGTGCATTATAAATTACTTTTTGAACCTATGTCTCGTGGTGTGTGCATAGCTTCTACTAACATGCTTCGGGATGATGAAGGCATGCACTTGCAATCAGCTGAGCGCCAAGCATTGTCTGAGTTCCTTATTCGGCATGAAAGTATTTTTACAGCAGGGGGAGGTCCGACACCATTCATAGAACATTGCATAGACACCGGAGATCACCCCCCGATAGCTGTGCCGCCCTATCGCCTTAACCCTTCCAAGAAGGAGACGATGAAGAATGGAATAGAGAAGATGCTGGCAGATGACATCATTGAAGAGTGCGAATCCGCCTGGTGCTCTCCTGCATTGATGATACCGAAGTCCAATGGTAATGTAAGATTCTGCGTGGATTACAGGCGCTTAAATGAAGTAACCAAATCGGATACTTACCCACTCCCACGCATTGATGATCTTCTCCAGAGTACGAAGAAGAATTGTTACATGACCACAATAGACCTTCGTTCTTCATATTGGCAAGTTATGGTCCGAGAAGCAGACAGAGACAAAACAGCTTTTGTCTGCCCCCTAGGCACTTACCGTTTTAAAAGAATGCCGTTCGGCTTGAAGAATGCGCCGGCGACTTTCCAAAGGCTTATTGATCGTCTACGCTCCTGTGCTGCTTTGAAGGATGTTACAGTACTTGCTTATCTAGACGATTTGTTAATTATTTCAGAAGGATTCCAGCAACACCTACAAGATCTGGAAGCTGTTTTTAGTCGTTTGTCTGAATTTAAACTTCACGTAAACAGAGAGAAGTGCACTTTTGCCAAAGAAAGGGTCCGTTATCTGGGCCACGTCATCACTCCAGACGGTGTGTCTCCTGACCCTGAGAAGGTCAGTGCTGTCCTTAATATGCTGGAACCATCTAACCTAAAACATTTAAAAACTTTTCTCCAAACATGCTCTTGGTTCAGGAAGTTTATTCCAAACTTTTCAAAGATAGCAGAACCGCTTACTCGACTGACCAAGAAGAATTACACATGGAGCTGGGGACCTGAACAAACACAGGCATTCAAAGAATTGAAGCGTCTGCTGACCACGGCGCCCGTACTTGTTCAAGCGAATTTTAAACAACCCTTAGTACTGCGTACCGACGCGAGCAACTATGCACTTGGCGCAGTTTTAGCTCAAGGGGAAGGCAAGGACGAAAGGCCTATCGAGTATGCTAGCCGCCTACTCACCGCAGCGGAGCGCAACTACTCTACTACAGAACGGGAAGCGCTTGCTGTAGTCTGGGCCGTGGAGCGTTTCAGGCCATACCTCGACGGCCAACCAATTATTATAGGCAGTGATCACCAACCCTTGCGTTGGTTGCTTTCTTTAAAGTCTCCTGCTGGTAGGTTGGTCCGTTGGGCGCTTAAACTCCAAGAATTTGACATCAGATTCGAGTACACCCCAGGAAAAGCTAACGTTGTCGCTGACACGTTAAGTAGACCGATCTGTTCCAACGAAACACAAAATAACTGCGGCATCTGTTCTGTCATTTGCGACCTGCCCACCAAGTCACCTACCCAGTTACGTCAAGACCAGTTGACTGATCCGGAAATACAGAAGATCGTCACAGAACTGGAAGGAGTGGATGAACTTGCTGCTAAAAGATGGTCAGAAAGAGGATTTCTAATGGAACAAGGTGTTTTATATCGACTTAATCCGGATTCTGATGCCGAGGCCCCACAATTAGTCATTCCTGCCCATCAAGTGACCGACGTTCTCAAAGAGCTTCACGATGCCCCTACCGCTGGACATGCAGGAATTGACCGGACTTACCAACAAGTCTCACGTCTGTTCTACTTCACAGGAATAAGAAGAATCATAACCGACTATGTAAAGGCATGTATCCATTGTCAACGCTATAAGGCTGCTAATACCAAGCCTCCAGGTCTATTGCAGACGCCGGTGATGAACCAGCGCAACGAAGTCTTGGCAGTTGATCTTTTCGGCCCGTTGCCACCTGGAAAACAGGGGGAGCGTTGGATCTTGCTTATAGAAGATACTGCTACGAGGTGGACAGAACTTTTCCCATTAAAGGAAGCTACTGCTGAGGCGTGTGCACATGTCCTCATAGAGGAGTATTTTATGAGGTTTGGTCTTCCACGCCGACTAGTTTCTGATAATGGCGTACAATTTATTTCGGCAGTCATGCGTCAATGCATGTCCATCCTGGGGATAAAGCAAAACCTTATCCCTCTCTATCACCCAGAAGCAAACCCCGCCGAACGTAAAAACAGAGATCTTAAGACTTTATTAGCACAACTCGTGGAATGTGACCACACTTCCTGGCCAAACATGTTACCAGTGATTCGATTCGCTCTTAATAACGCTAAATGTCGCACCACAGGTATGTCACCTGCTTACTTGTCATTTGGCAGAGAGATGAGGTCCCCCACAGAAGTCACCCATGACCTTCGTGCTGTTCTAGACAAAGATAACTTTGTTCCCCAAATAACTCCCTATCTCAGGAAATTTGTTAACTCCTTTTCAGCGGTGCGCGAACGTGTAGAGACGCTTCAAGATAAAGCTAAAGGGTATGCTGATCGTTCGAGACGGCCCATTGAAACATTCAACGAAGGTGACATGGTTCTCATCAAATCACATGTCCTCAGTAAGAGCGCTAATGGCCTTGCTTCTAAGTTTGTTCCAAAACGCGATGGTCCGTATCGCATCGTTAAAAAGGTCAGCCCTACTACTTACCACGTCGCGCATGTTGACAAACCTGATGAAGTTTTAGGGAAATATCATGTGAACGATCTCACTCTATACCGTGAGAATCAGAGTGATGCTCTTCCGCGGCCGGTGATGCCTAAAAAGAAACGTGGTCGTCCCCCAAATAATGTTAAAACAGATTCTCGAGTTCCAGGGCATATGACGACACGGCATGCTGAACCATGTGCTGAAGCTCCACGTCTTTCTCCCGCAGCTGGTGGTATGGTTGGTCTTGCGCCTGTCCCTCAGCCCAGTAGTAATGAGATGCTAGTCCAGGAGCGAGGGCGTCCTCCAGGACTAGAGGGGGAGTATGTAGCAAACCGACCGGTACGTCACTCTCGCGGCCGTATGCCCGCTCGCTATACATAG
Protein
MTVTQKAGSVVASVYDRESDDRYLHLRPIFKIQVLGKQGTALIDTAAKHCIAGHTLYALLLHKGHPLTPSTRRVKLADGHVRNMDVLTTILPVRLEHIVINIPFIIFPDSNDNETLLGIDFINAAKVIIDFHRHEWYFSTDAKVHYKLLFEPMSRGVCIASTNMLRDDEGMHLQSAERQALSEFLIRHESIFTAGGGPTPFIEHCIDTGDHPPIAVPPYRLNPSKKETMKNGIEKMLADDIIEECESAWCSPALMIPKSNGNVRFCVDYRRLNEVTKSDTYPLPRIDDLLQSTKKNCYMTTIDLRSSYWQVMVREADRDKTAFVCPLGTYRFKRMPFGLKNAPATFQRLIDRLRSCAALKDVTVLAYLDDLLIISEGFQQHLQDLEAVFSRLSEFKLHVNREKCTFAKERVRYLGHVITPDGVSPDPEKVSAVLNMLEPSNLKHLKTFLQTCSWFRKFIPNFSKIAEPLTRLTKKNYTWSWGPEQTQAFKELKRLLTTAPVLVQANFKQPLVLRTDASNYALGAVLAQGEGKDERPIEYASRLLTAAERNYSTTEREALAVVWAVERFRPYLDGQPIIIGSDHQPLRWLLSLKSPAGRLVRWALKLQEFDIRFEYTPGKANVVADTLSRPICSNETQNNCGICSVICDLPTKSPTQLRQDQLTDPEIQKIVTELEGVDELAAKRWSERGFLMEQGVLYRLNPDSDAEAPQLVIPAHQVTDVLKELHDAPTAGHAGIDRTYQQVSRLFYFTGIRRIITDYVKACIHCQRYKAANTKPPGLLQTPVMNQRNEVLAVDLFGPLPPGKQGERWILLIEDTATRWTELFPLKEATAEACAHVLIEEYFMRFGLPRRLVSDNGVQFISAVMRQCMSILGIKQNLIPLYHPEANPAERKNRDLKTLLAQLVECDHTSWPNMLPVIRFALNNAKCRTTGMSPAYLSFGREMRSPTEVTHDLRAVLDKDNFVPQITPYLRKFVNSFSAVRERVETLQDKAKGYADRSRRPIETFNEGDMVLIKSHVLSKSANGLASKFVPKRDGPYRIVKKVSPTTYHVAHVDKPDEVLGKYHVNDLTLYRENQSDALPRPVMPKKKRGRPPNNVKTDSRVPGHMTTRHAEPCAEAPRLSPAAGGMVGLAPVPQPSSNEMLVQERGRPPGLEGEYVANRPVRHSRGRMPARYT

Summary

EMBL
GFTR01008566    JAW07860.1    IAAA01017336    LAA03833.1    GEZM01007731    JAV94970.1    + More
KQ972234    EFA12514.2    GFTR01008489    JAW07937.1    GECL01003261    JAP02863.1    GACK01009040    JAA55994.1    GACK01009041    JAA55993.1    GACK01009043    JAA55991.1    GALX01005355    JAB63111.1    GACK01000334    JAA64700.1    GFAA01003652    JAT99782.1    GACK01009042    JAA55992.1    GACK01004027    JAA61007.1    LBMM01011454    KMQ86828.1    GACK01009039    JAA55995.1    KQ972733    KXZ75794.1    GEGO01002704    JAR92700.1    GFTR01008516    JAW07910.1    GBBI01004690    JAC14022.1    GFTR01008424    JAW08002.1    KF925840    AHN53418.1    GFAC01005811    JAT93377.1    GECU01030157    GECU01020076    JAS77549.1    JAS87630.1    GEGO01001242    JAR94162.1    GGLE01001609    MBY05735.1    GEGO01003620    JAR91784.1    LBMM01004568    KMQ92283.1    GGLE01003869    MBY07995.1    GEGO01004488    JAR90916.1    GEZM01020516    GEZM01020515    JAV89256.1    GEFM01006999    JAP68797.1    LBMM01013676    KMQ85528.1    GACK01002722    JAA62312.1    GCES01095459    JAQ90863.1    GACK01003086    JAA61948.1    GFJQ02004522    JAW02448.1    GEZM01046053    JAV77555.1    GEGO01001548    JAR93856.1    GEZM01099479    JAV53309.1    GACK01000363    JAA64671.1    GGLE01007069    MBY11195.1    GACK01009195    JAA55839.1    GACK01009547    JAA55487.1    GACK01000610    JAA64424.1    LBMM01010645    KMQ87338.1    GACK01004001    JAA61033.1    GEFM01006971    JAP68825.1    GACK01004074    JAA60960.1    GFAA01003693    JAT99741.1    GACK01003909    JAA61125.1    GEFH01002290    JAP66291.1    GEZM01035170    GEZM01035168    JAV83378.1    GAMC01021623    GAMC01021621    JAB84934.1    GBHO01041895    GBHO01025146    GBHO01025145    GBHO01025144    GBHO01025143    GBHO01014600    GBHO01014569    JAG01709.1    JAG18458.1    JAG18459.1    JAG18460.1    JAG18461.1    JAG29004.1    JAG29035.1    GACK01009237    JAA55797.1    LBMM01010896    KMQ87169.1    GBIH01000760    JAC93950.1    GBBI01004634    JAC14078.1    KK119366    KFM75488.1    LBMM01010852    KMQ87188.1    GEZM01005662    GEZM01005661    JAV96000.1    AFYH01233110    GEGO01004785    JAR90619.1    GACK01009357    JAA55677.1    LRGB01003288    KZS03371.1    KK112080    KFM56688.1    GFTR01008624    JAW07802.1    GBHO01002002    GBHO01001990    JAG41602.1    JAG41614.1    KK114971    KFM63831.1    LBMM01008414    KMQ88902.1    KK114965    KFM63797.1    KK118759    KFM73794.1    KK115210    KFM64429.1    LRGB01002748    KZS06406.1    KK116803    KFM68808.1    KK118857    KFM74035.1    GEZM01099475    JAV53313.1    KK116393    KFM67655.1    KK118517    KFM73152.1   
Pfam
PF17921   Integrase_H2C2        + More
PF00665   rve
PF17917   RT_RNaseH
PF00078   RVT_1
PF03732   Retrotrans_gag
PF17919   RT_RNaseH_2
PF09668   Asp_protease
PF00077   RVP
Interpro
IPR012337   RNaseH-like_sf        + More
IPR001584   Integrase_cat-core       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR041373   RT_RNaseH       
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR041577   RT_RNaseH_2       
IPR005162   Retrotrans_gag_dom       
IPR001969   Aspartic_peptidase_AS       
IPR003034   SAP_dom       
IPR036875   Znf_CCHC_sf       
IPR001995   Peptidase_A2_cat       
IPR019103   Peptidase_aspartic_DDI1-type       
IPR018061   Retropepsins       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=3.0254e-72,     Score=696

Ontologies

Topology

Length:
1174
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0650199999999997
Exp number, first 60 AAs:
0.01371
Total prob of N-in:
0.00320
outside
1  -  1174
 
 

Population Genetic Test Statistics

Pi
169.673688
Theta
149.960327
Tajima's D
-0.775061
CLR
0
CSRT
0.181390930453477
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号