SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07891
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.129 PlasmaMembrane   Reliability : 1.197
 

Sequence

CDS
ATGGACCCCCCGTCAGAATACGACGGCGACGTCCCTGCTGAGGTGCCCCATATAACGGGGGCGGAGCTCCATGTGGCAGTGCGTAAAATGTGCGCGAAGGACACTGCACCCGGCCCGGACGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTGGGGGACCGACTCTTGAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCTGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTAGTCATGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGTCCCTCTCGGATGAGGCCGTCTCCGGGGGTGGGGTGGCTTTGGCGGTGTCACTCGATATCGCCAATGCGTTCAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGACACGGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTGGAAGACAGATCGGTCACGTGTACCGGACACGGTGGGATCGTGCATCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGGGGTGCCCTCCTCCCGGGCCTGAGTGTAATCTGTTACGCAGACGACACGTTGGTCGTGGCCCGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACGGCTGGGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAATCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTCCTTCCCAATGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACAGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCTTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTCCTGGAGGCGGAGGCGCTCGCTGCTGACTATCAGTGGCGGGCTGACCTTCGTATCCGGGGCGTGGCACGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGGCATGGTCCAGACGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTTCTTGTGAATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGGCTTGGACACGGCGGAGCACACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTTGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACACGCAAGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MDPPSEYDGDVPAEVPHITGAELHVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVMVGPDLSAEQYGFREGRSTVDAILRVRSLSDEAVSGGGVALAVSLDIANAFNTLPWSVIGGALERHGVPPYLRRLVGSYLEDRSVTCTGHGGIVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGVLLSLPVLLRLGPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADLRIRGVARPSPSVVRARRAQSRRSVLEAWSRRLADPSAGRRTVEAIRPVLVNWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECHHCGCGLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTILQKEAAGRVRDTQARRRRAGAREADLAQALAL

Summary

EMBL
AB090825    BAC57926.1    AB078935    BAC06462.1    AB078930    BAC06454.1    + More
AB078931    BAC06456.1    AB078929    BAC06452.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    LBMM01003679    KMQ93242.1    LBMM01008682    KMQ88705.1    LBMM01005733    KMQ91252.1    LBMM01006954    KMQ90166.1    GGMR01000779    MBY13398.1    GGMR01014195    MBY26814.1    ABLF02011238    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    LBMM01002052    KMQ95336.1    GGMR01015159    MBY27778.1    LBMM01006063    KMQ90967.1    LBMM01007425    KMQ89740.1    LBMM01006110    KMQ90925.1    GFXV01002090    MBW13895.1    LBMM01003245    KMQ93755.1    ABLF02013358    ABLF02013361    ABLF02054869    LBMM01019839    KMQ83438.1    GGMR01004600    MBY17219.1    LBMM01014122    KMQ85315.1    GGMR01011682    MBY24301.1    ABLF02034925    GFXV01003903    MBW15708.1    ABLF02014378    ABLF02004854    ABLF02041317    ABLF02005203    ABLF02041316    GGMR01015354    MBY27973.1    ABLF02059310    ABLF02018808    GGMR01006838    MBY19457.1    GGMR01019493    MBY32112.1    ABLF02004597    ABLF02041324    ABLF02023257    KU543683    AMS38371.1    LBMM01004262    KMQ92649.1    GALA01001777    JAA93075.1    GGMR01012748    MBY25367.1    GEHC01000964    JAV46681.1    HACL01000281    CFW94575.1    LBMM01006977    KMQ90149.1    GGMR01009778    MBY22397.1    GALA01000302    JAA94550.1    GALA01001776    JAA93076.1    GAMC01020519    GAMC01020515    JAB86040.1    GAMC01020517    JAB86038.1    ABLF02020969    LBMM01008445    KMQ88871.1    GGFJ01001454    MBW50595.1    M93691    AAA29365.1    AAZX01001144    AB090813    BAC57902.1    GALX01004171    JAB64295.1    AB090817    BAC57910.1    ABLF02028779    ABLF02009709    ABLF02009711    AB090816    BAC57908.1    ABLF02011136    ABLF02014426    ABLF02009073    ABLF02030702    ABLF02042963    ABLF02018471    ABLF02058352    LBMM01013668    KMQ85535.1    GAKP01002292    JAC56660.1    GEBQ01030504    JAT09473.1    ABLF02030663    ABLF02041312    AB090820    BAC57916.1    AB090824    BAC57924.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF00098   zf-CCHC
PF13966   zf-RVT
PF13359   DDE_Tnp_4
PF12017   Tnp_P_element
PF00075   RNase_H
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR026960   RVT-Znf       
IPR021896   Transposase_37       
IPR027806   HARBI1_dom       
IPR012337   RNaseH-like_sf       
IPR002156   RNaseH_domain       
IPR036397   RNaseH_sf       
IPR016067   S-AdoMet_deCO2ase_core       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
SSF56276   SSF56276       
Gene 3D
PDB
6AR3     E-value=2.75563e-05,     Score=115

Ontologies

Topology

Length:
612
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.20954
Exp number, first 60 AAs:
0.00146
Total prob of N-in:
0.00148
outside
1  -  612
 
 

Population Genetic Test Statistics

Pi
3.283657
Theta
2.626298
Tajima's D
-0.960977
CLR
37.502802
CSRT
0.141442927853607
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号