SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07889
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.811
 

Sequence

CDS
ATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTGGCGAAGCTGCTGCAACAGCCGCAACGCACCATCGCGGTCAGGGTCATTCGTGGTTATCGCACCATCTCCTTCGAGGCGGCGTGTGTGCTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTGACCTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAATCATGGTCTAGGCGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCAGTCCTTGTGGATTGGGTGAATCGTGACAAAGGACGCCTCACTTTCCGGCTCACGCAGGTCCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCAGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGATTGCGACTTGGACATGGCAGAGCATACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTTAGAGACGCGCTAGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MALYGAPVWGQSLAVGVAKLLQQPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADLRARGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDKGRLTFRLTQVLTGHGCFGEFLHRIRAEPTAECHHCDCDLDMAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDALARRRRAGAREADLAQALAL

Summary

Cofactor
FAD
Similarity
Belongs to the GMC oxidoreductase family.
EMBL
AB126050    BAD86650.1    AB090825    BAC57926.1    LBMM01009501    KMQ88083.1    + More
KZ150386    PZC71062.1    KZ149950    PZC76665.1    AB078935    BAC06462.1    KZ150308    PZC71477.1    AB078931    BAC06456.1    AB078930    BAC06454.1    KZ149896    PZC78733.1    AB078929    BAC06452.1    LBMM01012027    KMQ86470.1    LBMM01006538    KMQ90523.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    RSAL01000481    RVE41577.1    D85594    BAA19776.1    ODYU01009945    SOQ54696.1    LBMM01008861    KMQ88580.1    KQ460685    KPJ12887.1    QOIP01000009    RLU18544.1    LBMM01003679    KMQ93242.1    LBMM01009494    KMQ88097.1    LBMM01014132    KMQ85305.1    GL450953    EFN80213.1    LBMM01006909    KMQ90209.1    RSAL01003504    RVE40273.1    LBMM01006657    KMQ90417.1    LBMM01024024    KMQ82631.1    LBMM01006954    KMQ90166.1    LBMM01005733    KMQ91252.1    LBMM01019838    KMQ83439.1    LBMM01006110    KMQ90925.1    LBMM01019839    KMQ83438.1    QOIP01000010    RLU18098.1    LBMM01006671    KMQ90407.1    LBMM01008682    KMQ88705.1    QOIP01000031    RLU14697.1    LBMM01004272    KMQ92618.1    LBMM01005634    KMQ91349.1    QOIP01000007    RLU20280.1    ODYU01005282    SOQ45985.1    KQ414641    KOC66782.1    LBMM01006662    KMQ90413.1    LBMM01007036    KMQ90099.1    LBMM01014909    KMQ85000.1    LBMM01011877    KMQ86578.1    LBMM01006063    KMQ90967.1    LBMM01002052    KMQ95336.1    ABLF02026677    ABLF02032994    ABLF02059021    ABLF02064578    GGMR01011974    MBY24593.1    ABLF02006132    LBMM01004634    KMQ92224.1    LBMM01006725    KMQ90373.1    GGMR01006442    MBY19061.1    LBMM01015018    KMQ84954.1    GGMR01016864    MBY29483.1    CH963857    KRF98317.1    LBMM01004505    KMQ92346.1    LBMM01008349    KMQ88951.1    ABLF02041886    ABLF02037241    ABLF02037246    ABLF02044766    GGMR01012534    MBY25153.1    ABLF02011238    LBMM01015025    KMQ84953.1    ABLF02017307    LBMM01006640    KMQ90440.1    ABLF02023401    ABLF02029423    ABLF02060278    GL437417    EFN70484.1    LBMM01002480    KMQ94776.1    LBMM01005216    KMQ91703.1    LBMM01003941    KMQ92969.1    LBMM01007425    KMQ89740.1    GGMS01002352    MBY71555.1    GFXV01002242    MBW14047.1    LBMM01007162    KMQ89979.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF07776   zf-AD
PF00096   zf-C2H2
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF00732   GMC_oxred_N
PF17919   RT_RNaseH_2
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR036188   FAD/NAD-bd_sf       
IPR012132   GMC_OxRdtase       
IPR000172   GMC_OxRdtase_N       
IPR041577   RT_RNaseH_2       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
SSF51905   SSF51905       
Gene 3D

Ontologies

Topology

Length:
253
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0670200000000001
Exp number, first 60 AAs:
0.06577
Total prob of N-in:
0.01456
outside
1  -  253
 
 

Population Genetic Test Statistics

Pi
14.671973
Theta
5.817342
Tajima's D
1.707038
CLR
0.433275
CSRT
0.849007549622519
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号