SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07849
Pre Gene Modal
BGIBMGA009519
Annotation
Yokozuna_[Bombyx_mori]
Full name
Retrovirus-related Pol polyprotein from transposon TNT 1-94      
Location in the cell
Nuclear   Reliability : 3.353
 

Sequence

CDS
ATGCGCTATGACAATGAAAGCAACTTACAGCAATATTTCCTAAAATTTGAAGGAATTCTTAGCGAATTAGCGGCAATCAACGTAAACGTCGATGTAGAAGACCAAATTTGCTATCTGCTGTCTTCTCTACCAAAGTTAAACGATCAAGTAATTACATCAATTGAGACTATGGCTTCCGAGAAACAGCTGAACCTAGAATTTGTTAAAGCAAGACTACTCGATATGGAGACAAAGTTAAAAATGGACAGAAATAGTGAAAGCTATGAGAATAATGCCTTCATCACGTGCCACTCCTGCGGAAAACGTGGACACAAATCATTCGAATGCCGAAGATCAGGACGAGGACAAGGGCCGAGTAGAGGACAGTCATTGACACGAGGATGGAGCTATCCAAGATCGCGTGGACGCTCATTTAGAGGAAATTCAAGTTCACGACATACAACGTATCAACATACTTCAGCAGCAGGCAGAGACGACAAAGAAATAGGTTTCATTGCTAGCAATATTATTGCTAATGTGGGTGAATGTGGTAACATAGAACTAATTATAGACTCAGGATGTACGGAGCATTTAATAAATGAAAAATATGAAAATTATATGACGGATATTACGTACTTAGATAAACATGTCAAAATATTCGTAGCTAACGGCCAATGTATTACAACTAGTAAAAGAGGTAAACTTAAAGTAAAATATCAAAATACTACGATTAATATTGATGCTCTAATTGTGAAAGATGTTTCATACAATTTGTTATCAGTGAAAAAGATTGTCGAGGCAGGTTTTAACATAAACTTTAATAAATACAATGTTAAAATATTTAATAAAAATACATTTTTATGCGGCACCGTGCAAGGAAAATTGTATAAGCTACAAGCCGAATTATGTAAGTCCGAAGTTTGTAATGTTACTGATGCGGCAGATCTATGGCACAAACGTTTAGGTCATTTAAATAGGAAAAGCCTTAATATACTAAAATTACCTGTATCTGATAGAATTTGCAGTCCCTGTATGGAGGGCAAAGCCACCCGAAGCCCATTCACGTCTATCCCAAAGCCTAGAACGAAAATGACAGCCGAGATGCTTCACACAGACATAGCAGGACCGATCAGACATCAAGGACCTAATGGTGAAAAATATTTTATGACAATTATTGACGATTTCTCTCATTTTTGCGTAGTGTATCCCCTGAAGAGCAAATCTGAAGCAACAGAACGACTGATGAACTATGTATTAAGAATTGAAAACGAAACGGGGAATAAAGTTAAAAGAATTAGATGCGATAATGGTGGAGAGTACACTGCTAATAGTTTGAAACTTTTTTGCATAAATAGAGGTATTAGTTTAGAATACACATTACCGTACACGCCACAACTTAATGGCATATCAGAACGGATGAACCGCACATTATGCGACAAAACGAGGACTCTATTAGCGGAAACCAATTTGCCAAAACATCTGTGGTGCGAAGCGATACAATGTGCAGTTTACCAATTAAACAGATCGCCATCATGGGCCATAAACTTCAAGACACCCAGCGGAATATTTTTTGGTAAAAACGACCTATCGAGATTGAGAGTATTTGGTTCCAAAGCTTGGGCTACTATAGTACCCAAACCGGACAAGTTTGCCAAGAGAGCAAAAGAAACAAGAATGGTAGGTTATGGAACTGTTGGTTACAGATTATGGGATCCAGAAGAAGATAAAATAGTTATTTCCAGAGATGTAAGATTTGATGAAAGCGATATTAAATTCAAAAATAACGAAGAAGTGAAACAAGTTAGATATATTCAAGACAAAGAAGAAGAAATCAATAAAGAAAATCAAGATATTGTAGAACAGGAAGATGAATTTAAAGATGCAGAAATGAACACTGATCAGATTGAAGAAGCAATAATCAGACCCAAAAGAACGATAAATCCTCCTGCTTATCTTAAAGATTACGAGACGAATATAGAAAACATAAATGAAACTAATATTGTTATATGTCTGAGTGCAAATGCACCAGAAACTTTCGAAGAAGCTATAAAAGAACCAGAATGGAAAAACGCAATCAATAAAGAGCTAGATGCACTCCAAAGAGTACAAACGTGGGAAGAACAAGAAATAACCGATGGAAGAAAGCTCATAGATACAAAATGGATATTTAAACAAAAAGAAGATGGAACAAAAAAGGCAAGACTGGTAGCTAGAGGCTTCCAACAAAAGAAAAAAGATATTTTTGACAGCGTTTATGCACCCGTTGCTAGACATTCAACCATAAGAATGATCTTATCAAAAGCTGTACAAGATGATTTAAAGATTATTCAACTAGACATTCCCACTGCATTCCTAAATGGAAAATTGAAGTCTGATGTATTTATCAAAATACCCCAAGGATTAGAAATAAAAAATAATAATAATACAGCATTAAAACTAAAGAGAGCATTGTATGGATTGATTGAATCACCAAAATGTTGGAATGAAACAATTGACGAATTTGCGAAAGCTAAGGGATTCCAAAGATCAGAATATGATTACTGTTTGTATTACAAAGAAGATTGCTGGATGCTCATTTACGTGGACGATATCCTAATCATTGGAAACGGGGAAGATATTATTAAAGCACTTAAGGAGGAGTTTAACGCAAAATATATGGGCGAAATGAAAAAACTTTCTCGGAATGGAAGTTAA
Protein
MRYDNESNLQQYFLKFEGILSELAAINVNVDVEDQICYLLSSLPKLNDQVITSIETMASEKQLNLEFVKARLLDMETKLKMDRNSESYENNAFITCHSCGKRGHKSFECRRSGRGQGPSRGQSLTRGWSYPRSRGRSFRGNSSSRHTTYQHTSAAGRDDKEIGFIASNIIANVGECGNIELIIDSGCTEHLINEKYENYMTDITYLDKHVKIFVANGQCITTSKRGKLKVKYQNTTINIDALIVKDVSYNLLSVKKIVEAGFNINFNKYNVKIFNKNTFLCGTVQGKLYKLQAELCKSEVCNVTDAADLWHKRLGHLNRKSLNILKLPVSDRICSPCMEGKATRSPFTSIPKPRTKMTAEMLHTDIAGPIRHQGPNGEKYFMTIIDDFSHFCVVYPLKSKSEATERLMNYVLRIENETGNKVKRIRCDNGGEYTANSLKLFCINRGISLEYTLPYTPQLNGISERMNRTLCDKTRTLLAETNLPKHLWCEAIQCAVYQLNRSPSWAINFKTPSGIFFGKNDLSRLRVFGSKAWATIVPKPDKFAKRAKETRMVGYGTVGYRLWDPEEDKIVISRDVRFDESDIKFKNNEEVKQVRYIQDKEEEINKENQDIVEQEDEFKDAEMNTDQIEEAIIRPKRTINPPAYLKDYETNIENINETNIVICLSANAPETFEEAIKEPEWKNAINKELDALQRVQTWEEQEITDGRKLIDTKWIFKQKEDGTKKARLVARGFQQKKKDIFDSVYAPVARHSTIRMILSKAVQDDLKIIQLDIPTAFLNGKLKSDVFIKIPQGLEIKNNNNTALKLKRALYGLIESPKCWNETIDEFAKAKGFQRSEYDYCLYYKEDCWMLIYVDDILIIGNGEDIIKALKEEFNAKYMGEMKKLSRNGS

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Keywords
Aspartyl protease   Complete proteome   Endonuclease   Hydrolase   Metal-binding   Nuclease   Nucleotidyltransferase   Protease   Reference proteome   RNA-directed DNA polymerase   Transferase   Transposable element   Zinc   Zinc-finger  
Feature
chain  Retrovirus-related Pol polyprotein from transposon TNT 1-94
EMBL
AB014676    BAA74713.1    GDHC01015802    JAQ02827.1    GBHO01027564    JAG16040.1    + More
GBHO01004832    JAG38772.1    GDHC01019310    JAP99318.1    GEDC01012841    GEDC01000503    JAS24457.1    JAS36795.1    GBHO01034731    JAG08873.1    GBHO01009623    JAG33981.1    GBHO01035173    JAG08431.1    GBHO01002761    JAG40843.1    GDHC01007058    JAQ11571.1    LJIG01022881    KRT78250.1    GEZM01042286    JAV79968.1    GEHC01000928    JAV46717.1    JXUM01155348    KQ572178    KXJ68066.1    JXUM01085595    KQ563513    KXJ73717.1    LBMM01007046    KMQ90088.1    LBMM01012492    KMQ86193.1    GFTR01008662    JAW07764.1    GEZM01072005    JAV65635.1    GEZM01098220    JAV53943.1    GBHO01034936    JAG08668.1    GGMR01018348    MBY30967.1    GBBI01004033    JAC14679.1    JXUM01136904    KQ568499    KXJ68982.1    JXUM01025857    KQ560736    KXJ81076.1    ABLF02041793    GECZ01025604    JAS44165.1    GEHC01000878    JAV46767.1    GEZM01028916    JAV86196.1    NKQK01000002    PSS35035.1    GBHO01002616    JAG40988.1    JXUM01011189    KQ560325    KXJ83029.1    KK112142    KFM56833.1    KQ483843    KYP40337.1    LBMM01012772    KMQ86003.1    GEHC01000966    JAV46679.1    GEZM01032204    JAV84770.1    JAV86195.1    GBHO01040663    JAG02941.1    KQ483522    KYP47640.1    GECZ01019212    JAS50557.1    CM003608    KYP66486.1    KQ483456    KYP50361.1    KQ483890    KYP39660.1    KQ484038    KYP38095.1    FJ544854    ACL97385.1    KQ484324    KYP35753.1    JN402333    AFB73912.1    FJ544857    ACL97387.1    FJ544853    ACL97384.1    GEHC01000959    JAV46686.1    ASHM01015075    PNX96991.1    GEDC01029908    JAS07390.1    KF740825    AIC77183.1    D83003    BAA11674.1    JN402332    AFB73911.1    AY009101    AAK12626.1    CM003610    KYP61490.1    FJ544851    ACL97383.1    FJ544856    ACL97386.1    NKQK01000016    PSS08126.1    OIVN01002656    SPD05381.1    KQ484186    KYP36645.1    CM003607    KYP67664.1    JXUM01060983    KQ562129    KXJ76624.1    OIVN01006239    SPD28653.1    KQ483417    KYP53032.1    ASHM01014005    PNX95963.1    OIVN01000991    OIVN01001835    SPC88370.1    SPC98114.1    KQ483702    KYP42748.1    OIVN01002055    SPD00174.1    OIVN01000404    SPC79669.1    PDCK01000039    PRQ60431.1    OIVN01002247    SPD01987.1    OIVN01000313    SPC78143.1    OIVN01002516    SPD04274.1    OIVN01003683    SPD12935.1    X13777    KQ485623    KYP31853.1    OIVN01000189    SPC75922.1    OIVN01004879    SPD19723.1    CM003613    KYP54398.1    OIVN01001130    SPC90232.1    DF973742    GAU39052.1    OIVN01002854    SPD06945.1    CM007892    OTG31811.1    CM007893    OTG30017.1    KQ485638    KYP31826.1    OIVN01000557    SPC82046.1    KYP61818.1    KYP63036.1    KQ484010    KYP38330.1    CM003606    KYP68287.1    GAKP01010102    JAC48850.1    OIVN01001052    SPC89229.1    KQ483853    KYP40164.1    OIVN01000521    SPC81512.1    OIVN01006261    SPD29147.1   
Pfam
PF00665   rve        + More
PF07727   RVT_2
PF13976   gag_pre-integrs
PF13961   DUF4219
PF00098   zf-CCHC
PF13358   DDE_3
PF16495   SWIRM-assoc_1
PF08534   Redoxin
PF00106   adh_short
PF14244   Retrotran_gag_3
PF00626   Gelsolin
PF08033   Sec23_BS
Interpro
IPR036397   RNaseH_sf        + More
IPR039537   Retrotran_Ty1/copia-like       
IPR001584   Integrase_cat-core       
IPR013103   RVT_2       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR025724   GAG-pre-integrase_dom       
IPR025314   DUF4219       
IPR038717   Tc1-like_DDE_dom       
IPR032451   SMARCC_C       
IPR036291   NAD(P)-bd_dom_sf       
IPR013740   Redoxin       
IPR020904   Sc_DH/Rdtase_CS       
IPR002347   SDR_fam       
IPR036249   Thioredoxin-like_sf       
IPR037944   PRX5-like       
IPR029472   Copia-like_N       
IPR007123   Gelsolin-like_dom       
IPR029006   ADF-H/Gelsolin-like_dom_sf       
IPR036180   Gelsolin-like_dom_sf       
IPR012990   Sec23_24_beta_S       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF50630   SSF50630       
SSF51735   SSF51735       
SSF52833   SSF52833       
SSF82754   SSF82754       
Gene 3D
PDB
3S3N     E-value=9.79046e-08,     Score=138

Ontologies

Topology

Length:
890
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02191
Exp number, first 60 AAs:
0.01934
Total prob of N-in:
0.00117
outside
1  -  890
 
 

Population Genetic Test Statistics

Pi
384.144368
Theta
238.766886
Tajima's D
1.826857
CLR
0
CSRT
0.856507174641268
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号