SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07830
Pre Gene Modal
BGIBMGA000932
Annotation
PREDICTED:_serine/threonine-protein_phosphatase_rdgC_[Bombyx_mori]
Full name
Serine/threonine-protein phosphatase       + More
Serine/threonine-protein phosphatase with EF-hands      
Serine/threonine-protein phosphatase rdgC      
Alternative Name
Retinal degeneration C protein
Location in the cell
Nuclear   Reliability : 2.096
 

Sequence

CDS
ATGTTAGCCGCAGCCATTCCTAAATCCCGCGAAAAAGTGCCAAGATGCAATCGAAAGCGAAGAGATAAAAGCCACAGAGTAAGGGCCAAGAGTCCCACGATGTTTTCTTTGGCTGAGGGTTGTGGGTGCGTTAGTTTTCGTGGCGGTCGACGTACTCGCTCCCAAGGAGATGATTCTTCATCATGTCGGAGCTCAGAAATAGAACAAGAGGTTCCCCAAAGATCGGGTAAAAGACTACTCAATGGCGAATATACCATGAAAGCTTTGGTACCCTTCTTGAAATTTTGGAGAAGAGACGATGTTAGTATGACTAAAGCTGAAAGAACTATGAAAGCCGCCATTTTAATTCAGCAGTGGTACAGGCGTTATTTAGCGCGAATGGAAGTGAGAAGGCGTTATACCTGGACCATATTTCAGAACATTGAATATGCGGGCGAACATGATCAAGTGAAGCTGTATAATTTTTTCAACGCACTGCTCAGCCATATGATGGATACGAATGGGCGGCCCTCCTCCGAGCGTACCTCGAGAACAGCTTCCGTCTTGGAACAAGTTTTTTCCGAAGAGTCTGACGAAGGAGGGGGCGTCGATGAGACCGCTCCCCCGAAGCCTTCACGTGGCCCCGACGTTGAATTCCCGCTACAAAGAAAGGATATCGACCTATTGATTGAGGCATTCAGAAAGAAAAAGCATCGTTTACATCCAAAGCACGTAGCGCAGATACTGAAAGAGGCCACACAAGTATTGAAAAGGTTACCCAATATCAATGTGGCTACCACATCTATATCTAGCCAGATCACTGTTTGCGGAGATCTCCATGGAAAACTAGACGATCTACTCGTCATATTTCACAAGAATGGGCTGCCATCTCCAGAAAATCCGTATATATTTAACGGAGACTTTGTGGACAGAGGCAAGAAGGGTCTAGAAGTGTTTCTTCTGCTGTTAGCGTGCATGCTCGCTTTTCCCGGTGGTGTTTTCTTGAATCGCGGGAATCACGAAGATCTCATTATGAATTCGAGGTACGGCTTCATCAAAGAAGTTCACATGAAGTACAGGCACAATGCTGAGCGTCTTTTGAAACTGATTGAGTGCGTGTATCGGTGGCTTCCACTCGGGACCATCATAAATAATCGAGTTTTCGTTGTCCACGGAGGCATCTCGGATACTACAGACCTAGATATGATTCGGAGCCTTGAAAGGGATAAGTACGTGTCGCTTCTGCGGCCGCCGGTGATCGAGGGCTCAACGGCCGCGGAGTCGATAGATAAGGTGGAGTGGAAGCAGGTGTTTGATATACTGTGGTCGGATCCACAATGCATCGGAGGATGTGTGGCAAATGCGCTTCGAGGAGCAGGAACCTACTTCGGCCCTGATGTAACAGCGTCGTTCCTCCAGAAGAATAAGCTGAGCTTCATAATTAGAAGTCACGAGTGCAAGCCCGGTGGATACGAAATCATGCATGGCGGTAATGTAATTACAATTTTCTCGGCGTCGAACTATTACGAGTTGGGTTCCAACAAGGGCGCTTACCTGAAACTATGCGGGAACTCGTTGGAGCGCCAGTTCGTGCAATACACGGCGGCCGTGTCTCGCACGCGGCGTCTCACCTTCAGGCAGCGGGTTGGCCTTGTCGAATCGTCCGCCATGAGGGAGCTACACAATCAGATTATGATGGCCAGGAGATCTCTGGAAGCTACTTTCCGTAGCTTGGACTCGGAGCAAAGTGGTTTCATATCTATAAGCGATTGGTGTCAAGCCATGGAGGAGACAACACACCTCGGTCTCCCGTGGAGGATGCTTAAAGACAAGCTTGTTCGCACAGATCCCGAGACACGCAAAGTACGTTACATGGATACATTCGAACTCAACACCAATAGGAACGGACGAAAATCTGACACGCTGACAGTCGTCGAGACTTTGTATAAAAATCAAAGAAGCTTGGAGGCGATCTTCAAGATATTGGATAAAGATAATTCTGGTTACATAACGTTGGAAGAATTTTCCGAGGCTTGCCAGCTGATCGGCAAGTACATGCCGAATCCGATGACGCAGGAGCAGCTCGTCGACATCTGTCGGCTCATGGACATCAACAAGGACGGCCTGGTTGATCTCAACGAGTTCCTCGAGAGTTTCCGTCTCGCCGAAAAGAGTTTACACGAGCAGGAAAGGATGTACGAAGACATGCAGGCTACCTGA
Protein
MLAAAIPKSREKVPRCNRKRRDKSHRVRAKSPTMFSLAEGCGCVSFRGGRRTRSQGDDSSSCRSSEIEQEVPQRSGKRLLNGEYTMKALVPFLKFWRRDDVSMTKAERTMKAAILIQQWYRRYLARMEVRRRYTWTIFQNIEYAGEHDQVKLYNFFNALLSHMMDTNGRPSSERTSRTASVLEQVFSEESDEGGGVDETAPPKPSRGPDVEFPLQRKDIDLLIEAFRKKKHRLHPKHVAQILKEATQVLKRLPNINVATTSISSQITVCGDLHGKLDDLLVIFHKNGLPSPENPYIFNGDFVDRGKKGLEVFLLLLACMLAFPGGVFLNRGNHEDLIMNSRYGFIKEVHMKYRHNAERLLKLIECVYRWLPLGTIINNRVFVVHGGISDTTDLDMIRSLERDKYVSLLRPPVIEGSTAAESIDKVEWKQVFDILWSDPQCIGGCVANALRGAGTYFGPDVTASFLQKNKLSFIIRSHECKPGGYEIMHGGNVITIFSASNYYELGSNKGAYLKLCGNSLERQFVQYTAAVSRTRRLTFRQRVGLVESSAMRELHNQIMMARRSLEATFRSLDSEQSGFISISDWCQAMEETTHLGLPWRMLKDKLVRTDPETRKVRYMDTFELNTNRNGRKSDTLTVVETLYKNQRSLEAIFKILDKDNSGYITLEEFSEACQLIGKYMPNPMTQEQLVDICRLMDINKDGLVDLNEFLESFRLAEKSLHEQERMYEDMQAT

Summary

Description
Phosphatase required to prevent light-induced retinal degeneration.
Catalytic Activity
H2O + O-phospho-L-threonyl-[protein] = L-threonyl-[protein] + phosphate
H2O + O-phospho-L-seryl-[protein] = L-seryl-[protein] + phosphate
Cofactor
Mn(2+)
Similarity
Belongs to the PPP phosphatase family.
Keywords
Calcium   Complete proteome   Hydrolase   Magnesium   Manganese   Metal-binding   Protein phosphatase   Reference proteome   Repeat   Sensory transduction   Vision  
Feature
chain  Serine/threonine-protein phosphatase rdgC
EC Number
3.1.3.16
EMBL
KQ460205    KPJ16901.1    BABH01000935    KQ459606    KPI91275.1    AGBW02011268    + More
OWR46920.1    KQ971338    EFA01582.2    ADMH02000929    ETN64645.1    CH477268    EAT45428.1    ATLV01023923    KE525347    KFB49928.1    AAAB01008966    EAA12933.4    UFQS01000791    UFQT01000791    SSX06909.1    SSX27253.1    JXUM01007767    JXUM01007768    JXUM01007769    JXUM01007770    JXUM01007771    JXUM01007772    KQ560247    KXJ83583.1    GEDC01009827    JAS27471.1    GEDC01030006    JAS07292.1    GBHO01023525    GBHO01023524    GDHC01015922    JAG20079.1    JAG20080.1    JAQ02707.1    AXCM01005116    JRES01001542    KNC22133.1    LJIG01022522    KRT80131.1    DS235760    EEB16582.1    DS231858    EDS38870.1    CCAG010002954    CCAG010002955    CCAG010002956    UFQS01001279    UFQT01001279    SSX10107.1    SSX29829.1    KB632337    ERL92855.1    GAMC01016156    GAMC01016155    JAB90400.1    CCAG010000237    CH954178    KQS44297.1    JXJN01007898    JXJN01007899    CM000159    EDW95211.1    CM002912    KMZ00725.1    CCAG010004851    CH902618    KPU78056.1    OUUW01000009    SPP84720.1    KQS44298.1    KRK02291.1    EDV52482.1    KMZ00727.1    KRK02292.1    CH480826    EDW44181.1    KMZ00726.1    CH963847    EDW72874.2    M89628    AE014296    BT015959    KPU78057.1    CH379069    KRT07671.1    EDV39462.1    SPP84721.1    CH940647    KRF84894.1    KRT07672.1    KRT07673.1    KRT07669.1    EDY73443.1    CVRI01000047    CRK98102.1    CH933809    KRG06630.1    CH916366    EDV96600.1    EDW70401.1    KRG06631.1    EDW19411.1    CP012525    ALC44362.1    CH479188    EDW40193.1    PZQS01000003    PVD35141.1    GFPF01011705    MAA22851.1    GEDV01005900    JAP82657.1    NOWV01000006    RDD46763.1    CMVM020000240    LN609529    CEF68045.1    DS469522    EDO47034.1    LSMT01000037    PFX31297.1    JH712149    EJD75329.1   
Pfam
PF13499   EF-hand_7        + More
PF13202   EF-hand_5
PF00612   IQ
PF00149   Metallophos
PF08321   PPP5
PF13833   EF-hand_8
Interpro
IPR029052   Metallo-depent_PP-like        + More
IPR012008   Ser/Thr-Pase_EF-hand_contain       
IPR002048   EF_hand_dom       
IPR011992   EF-hand-dom_pair       
IPR006186   Ser/Thr-sp_prot-phosphatase       
IPR018247   EF_Hand_1_Ca_BS       
IPR004843   Calcineurin-like_PHP_ApaH       
IPR000048   IQ_motif_EF-hand-BS       
IPR013235   PPP_dom       
IPR041767   MPP_RdgC       
SUPFAM
SSF47473   SSF47473       
Gene 3D
PDB
3H69     E-value=2.84228e-63,     Score=616

Ontologies

Topology

Length:
732
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
7.50338999999999
Exp number, first 60 AAs:
0.00879
Total prob of N-in:
0.25924
outside
1  -  732
 
 

Population Genetic Test Statistics

Pi
252.16079
Theta
186.796423
Tajima's D
0.987717
CLR
0.311684
CSRT
0.656917154142293
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号