SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07817
Annotation
PREDICTED:_uncharacterized_protein_LOC106648510_[Trichogramma_pretiosum]
Full name
Galactose-1-phosphate uridylyltransferase      
Location in the cell
Nuclear   Reliability : 2.013
 

Sequence

CDS
ATGGAGGCAAACGAACAATTCGTAAGAGAAGAAAATACACTGTTACTACAACAAAATGCCATCCTAAAGGCTGAGTTACAAAAACTTAAAATGCAAGGCATTGATAAAACGGACCCACCCCCCACAGATCCATTATTTCCTCAACCTACCTCAGTATGCAGAGTAGCCATAAAACTTCCTCCCTTCTGGCCTGATCGGCCTGCAATTTGGTTTGCTCAGGTAGAGACACAATTCTCGATTTCAGGCATCTCCGCTGACCGGACTAAATTTAACTATGTGATTGCTCAGTTAGATACCCGAGTTATTGGGGAGGTGGAGGACATTATTCTCGAACCACCATCCGAGGACAAATATGGTCGCCTCAAATCCGAATTGATCCGTAGGTTGTCCACATCTGAGGAGCAACGTGTCAGGCAACTTGTCAGTAAGGTTGAGTTGGGTGACCACCGTCCTTCGCAGTTTTTACGTCATCTTAGATCATTGGCAGGAAACACCCTCACTGATGAAAATTTGCTTCGCCAGCTATGGATGCGTCGCTTCCCACAACATCTCCAAGCAATTTTGGCCGCCCAATCAGAACTCTCGCTGGACAAAGTCGCTGAGCTAGCGGACAAAATTTTGGAAGTTTCGCCTGGTATGGTCGCACCTCATTCATCTGCTGTTTTCTCAGCAAGCACGTCTGCCGTCTCACCCCCTTCGTTAGAAGGTATCACACGGCATCTGGATGAGGTCACGCGTCAGCTTGCTGTGCTTACTGCAGAGCGCGGTAGAAATAGGACCCGGGATTTCTCAAACCAGCGACGACGCTCACAAACGCCTGGTAAGCTTCAAATGTGCTTTTACCATAAGAAATTTAATACTAAGGCTGTTAAGTGTATTCAACTATACACAGGCTCCGACCTCTCCTGTTACCCATACCAGTGGTTAGCAAATAAGCCGGTACGTTCAAACTATACGTTAGCGGCTGCCAATGGTAGTGAGATACTCACTTTTGGTCACATAGAAATGGCGCTTAATTTGGGGCTACGCCGCACATTTCAATGGCAATTTATTATCGCTGACGTCGACACCGCCATCATCGGCTCCGATTTTCTGGCGCACTATCGGTTGTTGCCAGATTGTGCCAGTAAGAGACTCGTCGATAGCATTACCGGGTTGTCATGCGTTTCTGCCGTCGCTGTTTTAGACCAGACCAGCTTCAAAGTTGTCTGCGCTCCGTCATCCCAATTTAGTGCACTTCTTGCGGAATTTCCGTCCATTACGAAGCCACCAGTACTTATTCGTGAGCCGAAGCATAACACAGTTCATTATATTCTAACCACTGAGGGCGCCCCAGTCTCTTGTCGTCCTAGACGTCTGGCACCTCAAAAACTTCAAGAGGCCAAAAAGGTTATTGATGATATGGTACAGTGCGGGACAGCCAGACCTTCGAAAAGTTCGTGGTCTTTTCCACTTCATATGGTCCCTAAGCGCGACGGCACCTGGCGACCCTGCGGCGATTATCGTGCGTTGAATTCACGTACCATACCCGACAGGTACCCAGTTCGCCATATCGGTGACGTCGGCCATAACATATCTGGGTGTAGTATATTTAGTACAATCGACCTCGTTAAGGCATATCAGCAAATTCCTGTTGCGCCTGAGGATATCTGTAAAACCGCCATCATAACACCCTTCGGACTCTACGAATTTAATTACATGACTTTTGGTCTGCGCAACGCAGGCCAAACGTTTCAAAGATTTATAGACGAAGTTGTCCAAGGTCTCGACTTTTGCTTTGCGTACGTTGACGACATATTAGTGTATTCCCGTGATGCTCTTCAACATGCTGCACACCTTCGTACTCTTTTCAAGCGATTTGAAGATTACGGAATCGTTATAAACCCTGCAAAATGCGTGTTTGGTGCCCCTGAGGTTACTTTTCTCGGAAACAGAATATCCGCCGACGGAACACAACCACCATCAGAGCGCATTCAAGCTCTAAAGGATTTTCCTCTACCACAGACCGTACAAGGACTCCGTCGTTTCATTGGGATGGTTAATTATTATCGCCGATTTCTGCGCAATGCGGCGAAGTTACAAGCACCGCTAGTCAACGCAATCGTGGCCGCTGGAGGTAAAGCTCTCACACTGATCACTTGGACACCGGAGCTCGAGGAATGCTTTAATGCCTGTAAAGATAGCTTGTCATCTGCAGCTCTGTTGGCACACCCTTTGCCTAACGCTGAACTGGGGCTTTTCACCGACAATTCTCACGTTGGTGCCTGCCTTCAGCAGAAAGTCAGTGATGCTTGGCAACCCCTGGGTTTCTTTAGTAAAAAGCTGAATCCCCGACAGTGCCAGTGGCCAGCATACTACCGAGAACTTTTTCCGGTATATGAGAGTGTGCAACATTATCGACACTTCCTAGCCGCACAACACGTAACGATTTATACGGACCATAAGCCATTAGTTTACGCGTTCTCGCAACGTAGCGAAAGGCTTCCTCCGGTACAGTTAAATCAACTGTCTTTTATTTCGAAGTTTACCACGGACATTGTCCATATAAAAGGGGTGGATAATACGGTGGCGGACGCCATGTCCCGCATCGAAGCTGTTAGTTTTGAAACTGACCATTCTGCTCTCTCCACTTGCCAAAAACTTGACGACGAATTGAAAAAGTATCGTAACGATGGAAATTCTTCTCTTAAACTAGAAAACGTCTTAGTTCCTGGTACAAACACTGTTTTGATCTGCGACATGTCCACTGGGCGACCACGCCCATTTGTATCGGAACCTATGCGAAAGAAGATTTTTGCTCAGCTACATAATCTTAGCCATCCTGGTACTAGATCAACCATTCGATTGATCTCAGACCATTTCATGTGGCCTGGCATTGCTAAAGATTGCCGTTATTGGTGCCAAGCCTGCGTTGCTTGCCAGCAAAGTAAGGTGGCGCGGCATATAAAATCTCCACTTGGACACTTCTCCAGTCCTAAGTCTCGGCTGAAGCATGTCCATATTGACATCATAGGCACTCTTCCATCTTGTTCTGACTTCCAATACTGCCTGACTGCTGTGGATCGCTACACTCGATGGCCCGAAGTTTGGACTATGCACGGAATAACAGCAGAAGAAGTGGCGAGCACCTTTGTAGCCGGTTGGATTGCTCGATTCGGAGTACCTGCTGTCATCACAACTGACCAGGGACGACAGTTCGAGTCGGACCTTTTCAGACGCCTTACTAATTTATGTGGTACTAAACGTTTACGCACTACTAGTTACCACCCTTGTGCCAATGGGCTCGTGGAGCGCATGCATAGACAATTAAAGGCCTCTCTAATGTGTTATGATGATTCGTGA
Protein
MEANEQFVREENTLLLQQNAILKAELQKLKMQGIDKTDPPPTDPLFPQPTSVCRVAIKLPPFWPDRPAIWFAQVETQFSISGISADRTKFNYVIAQLDTRVIGEVEDIILEPPSEDKYGRLKSELIRRLSTSEEQRVRQLVSKVELGDHRPSQFLRHLRSLAGNTLTDENLLRQLWMRRFPQHLQAILAAQSELSLDKVAELADKILEVSPGMVAPHSSAVFSASTSAVSPPSLEGITRHLDEVTRQLAVLTAERGRNRTRDFSNQRRRSQTPGKLQMCFYHKKFNTKAVKCIQLYTGSDLSCYPYQWLANKPVRSNYTLAAANGSEILTFGHIEMALNLGLRRTFQWQFIIADVDTAIIGSDFLAHYRLLPDCASKRLVDSITGLSCVSAVAVLDQTSFKVVCAPSSQFSALLAEFPSITKPPVLIREPKHNTVHYILTTEGAPVSCRPRRLAPQKLQEAKKVIDDMVQCGTARPSKSSWSFPLHMVPKRDGTWRPCGDYRALNSRTIPDRYPVRHIGDVGHNISGCSIFSTIDLVKAYQQIPVAPEDICKTAIITPFGLYEFNYMTFGLRNAGQTFQRFIDEVVQGLDFCFAYVDDILVYSRDALQHAAHLRTLFKRFEDYGIVINPAKCVFGAPEVTFLGNRISADGTQPPSERIQALKDFPLPQTVQGLRRFIGMVNYYRRFLRNAAKLQAPLVNAIVAAGGKALTLITWTPELEECFNACKDSLSSAALLAHPLPNAELGLFTDNSHVGACLQQKVSDAWQPLGFFSKKLNPRQCQWPAYYRELFPVYESVQHYRHFLAAQHVTIYTDHKPLVYAFSQRSERLPPVQLNQLSFISKFTTDIVHIKGVDNTVADAMSRIEAVSFETDHSALSTCQKLDDELKKYRNDGNSSLKLENVLVPGTNTVLICDMSTGRPRPFVSEPMRKKIFAQLHNLSHPGTRSTIRLISDHFMWPGIAKDCRYWCQACVACQQSKVARHIKSPLGHFSSPKSRLKHVHIDIIGTLPSCSDFQYCLTAVDRYTRWPEVWTMHGITAEEVASTFVAGWIARFGVPAVITTDQGRQFESDLFRRLTNLCGTKRLRTTSYHPCANGLVERMHRQLKASLMCYDDS

Summary

Catalytic Activity
alpha-D-galactose 1-phosphate + UDP-alpha-D-glucose = alpha-D-glucose 1-phosphate + UDP-alpha-D-galactose
Similarity
Belongs to the galactose-1-phosphate uridylyltransferase type 1 family.
EC Number
2.7.7.12
EMBL
LBMM01012479    KMQ86204.1    ABLF02030693    ABLF02030697    KL367564    KFD63933.1    + More
KL367778    KFD59660.1    LBMM01009142    KMQ88359.1    LBMM01013040    KMQ85849.1    AAGJ04130731    KQ971355    EFA07205.2    KL367543    KFD65158.1    KL367544    KFD65142.1    LBMM01013103    KMQ85815.1    DF142933    GAA49140.1    KQ972957    KXZ75711.1    GFXV01006394    MBW18199.1    GBXI01015889    JAC98402.1    AAGJ04000250    FN356213    CAX83702.1    KL363241    KFD51254.1    GBXI01017046    JAC97245.1    JYDV01000002    KRZ45603.1    JYDV01000289    KRZ22781.1    AY013563    AAK07485.1    LBMM01012451    KMQ86215.1    KFD63920.1    JYDR01000002    KRY79251.1    AY013569    AAK07487.1    AAGJ04172791    GGLE01003443    MBY07569.1    EF426679    ABP48077.1    AAZX01006801    AAZX01023483    LN877232    CTR11708.1    AAZX01023279    GEGO01004484    JAR90920.1    ABLF02058233    JWZT01004124    KII64665.1    JWZT01005177    JWZT01001778    KII61927.1    KII71382.1    JWZT01003175    KII67485.1    JWZT01002058    KII70465.1    ABLF02057446    ABLF02059301    GEGO01004475    JAR90929.1    LBMM01001181    KMQ96765.1    AAZX01013940    ABLF02005645    ABLF02042063    GBXI01003773    JAD10519.1    KL367655    KFD60653.1    JYDT01000067    KRY86703.1    GFDL01003994    JAV31051.1    KL363373    KFD46409.1    JYDJ01000353    KRX36608.1    GEGO01004649    JAR90755.1    GEGO01003687    JAR91717.1    JYDR01000355    KRY64563.1    GEGO01000286    JAR95118.1    GGLE01001814    MBY05940.1    ABLF02040931    ABLF02040938    GEGO01003506    JAR91898.1    JWZT01001363    KII72172.1    GDKW01003376    JAI53219.1    MRZV01001828    PIK35719.1    AAZX01009606    KQ973093    EFA13472.2    GEDV01001796    JAP86761.1    GACK01008900    JAA56134.1    AAGJ04112098    AAZX01004786    ABLF02006595    ABLF02011068    ABLF02055413    AAGJ04001742    GGFK01003401    MBW36722.1    LBMM01012134    KMQ86388.1    AAGJ04164195    AAGJ04164196    AAGJ04164197    GGFK01003442    MBW36763.1    GEGO01004686    JAR90718.1    AAZX01023264    KL367479    KFD72009.1    MRZV01000197    PIK55880.1    GFPF01012375    MAA23521.1    AAZX01023342    LBMM01012160    KMQ86374.1    GDHF01001116    JAI51198.1    GDHF01021808    JAI30506.1    GDHF01014424    JAI37890.1    GBYB01009311    JAG79078.1    MRZV01002078    PIK34788.1    KL367552    KFD64647.1    GEGO01001281    JAR94123.1    HE601625    CCD77521.1    JYDH01000101    KRY32299.1    ABLF02006352    ABLF02013150    ABLF02013854    ABLF02041505    KL367664    KFD60497.1    LBMM01012633    KMQ86092.1    KL363200    KFD55401.1    NIVC01003188    PAA52757.1   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00665   rve
PF17917   RT_RNaseH
PF01087   GalP_UDP_transf
PF00077   RVP
PF00176   SNF2_N
PF00271   Helicase_C
PF05918   API5
PF13359   DDE_Tnp_4
Interpro
IPR012337   RNaseH-like_sf        + More
IPR001995   Peptidase_A2_cat       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001969   Aspartic_peptidase_AS       
IPR034132   RP_Saci-like       
IPR041373   RT_RNaseH       
IPR005849   GalP_Utransf_N       
IPR019779   GalP_UDPtransf1_His-AS       
IPR001937   GalP_UDPtransf1       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036265   HIT-like_sf       
IPR013032   EGF-like_CS       
IPR018061   Retropepsins       
IPR016024   ARM-type_fold       
IPR014001   Helicase_ATP-bd       
IPR001650   Helicase_C       
IPR008383   API5       
IPR038718   SNF2-like_sf       
IPR027417   P-loop_NTPase       
IPR000330   SNF2_N       
IPR027806   HARBI1_dom       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF54197   SSF54197       
SSF56219   SSF56219       
SSF52540   SSF52540       
SSF48371   SSF48371       
PDB
4OL8     E-value=3.26515e-64,     Score=626

Ontologies

Topology

Length:
1113
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03127
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00026
outside
1  -  1113
 
 

Population Genetic Test Statistics

Pi
217.028845
Theta
197.007678
Tajima's D
0.439927
CLR
0.501019
CSRT
0.496925153742313
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号