SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07739
Annotation
PREDICTED:_craniofacial_development_protein_2-like_[Bombyx_mori]
Full name
Queuine tRNA-ribosyltransferase accessory subunit 2      
Alternative Name
Queuine tRNA-ribosyltransferase domain-containing protein 1
Location in the cell
Nuclear   Reliability : 2.131
 

Sequence

CDS
ATGCGCAGCTACAAACTTGAGATTCTTGGCATTTCAGAAACTAGATGGAAGGGTTTTGGAGAACACCAAGAAGATGATATGACTTTCATTTATTCAGGCAAAGATATCACTGATAACCATGAATCAGGCGTGGGTATTTTAATGACCACCAACGCTAAGAGCAGTTTGCTCGACTGGCATCCTGTTTCGGACCGAATAATAATGGCACGTTTTTACTCAAGAGTGCGGAACATCTCAGTCATACAATGCTATGCGCCTACAAATGCAGCGAGTTCAGTCACAAAAGCAAAGTTCTACAGTCACTTGCAATCGACTCTGCAGAAGATAAAGCGCCAAGATATTGTTATCTGCATGGGAGACTTCAACGCCCAACTGGGATCAGACAACACGAACATTGAGCCTTGGCTAGGTAGACACGCGATGGGACGGAGATCTGAAAACGGTGATATGCTCATAGATCTCTGCTGTCAAAATGACCTCATAGTGGGGGGATCTATTTTCCCTCATAAGAGTTGTCACAAAGTTACATGGGTTTCACCTGACCGTATCACAGAGAACCACATCGACCATGTGTTGATAAGTCGCAAGTGGAGAAGATCCCTTCTAGACGTTCGCAATAAAAGAGGTGCGGACATAAACAGCGACCACCACCTGGTTGTGGCAAAGATAAAACTAAAAGTAGCGAAAATCCAGCGGACTGCCAAAACAGCAAGTAGGAACTTTGATACAGAGAAGCTTCGGAATCCAACCACAAAACAAAATTTCCAAGACGACCTCCGTAATCGTACTGTTAACATTAGCTGTGAAGAAGGGACTATCGAAGATCATTGGGAGTCTGTTAGAGGCGCATTCCGTGAAAGCTGCCAGTCTGTGCTTGGTTACAAATGCACGCCTAAAAAGAAATGGATCTCAGGAACCACTTGGGACATGATCCAGGCAAGGCAGCAAAAGAAAGAGCAGATCAACTCTGCACAAACTCTGGAAGCCAAAGAAGAACTAGCTTATGAGTACTACATTTGTGAGTCAAAGATCAAACTCAACCTAAAGAAAGACAAACGAGCTTGGACTGAAGCTATAGCACAGAAAGCAGAGCTGGCGGCATATTCTGGAAACATGTCAGAGTTACATAAATCAGCAAAAATCCTCTGCAATAAACCAATCGCTGATAAACCACTGAGGGATGACGCCGGAAATCTACTAGTTACCTTAGAGCAACAACTGGTTGGATGGCGTGAGCACTTTGCTAAGGTCTTCGAAGCTCGGCCCACGGCGACTATCGTTGGACACGAGCCTTCTCAGAAACTACTCGATATTGAAGTGGGCCCTCCAGTCGTAACCGAGATTAAAAAGGCAATCACATCTCTAAAATCTGGCAAGGCTCCCGGTGGCGATGGCATTACGGCTGAAGAGATGCAGTGTGAAGTTTTCACATTGTTTATCGACTTCGAAAAGGCCTTTGACAGTGTCAGTTGGTCCAGCATTTGGACTGTTTTGAAGAAAAAAGGCGTGCCCGACAAGCTCATAAATGTCATAAAAGCGCTTTACTATGGATCGTCGTGTAGAGTGCTCCACAGGGGAAAACTCACGGATAATATCGTGGTCACCGCAGGCGTCAAGCAAGGTTGCTTGCTGTCTCCCCTGCTGTTTATAATGGTGCTTGATGTTGTGATGCGCAGAGTCACCTATGATCTAGTAGATGAAGCTGAAAAAGCAGGGCTGCGTATTAATTTCTCAAAAACAAAAGAAATGCGCATAAATACCACCGATTCGGCTCCTATGTCGATCAAAGGGAGGCACATCGAGCGGGTGGGAAGCTTCTGTTACCTGGGCAGCATTGTGGATGATAGGGGAGGCACCGAGGCAGACATTGCGGCTCGTATAAATAAAGCCAGAGCCGCGTTTAGTCAACTTAGGCCAGTAGAAAATGAAACAATCGGTGTTACTATTTATGGCGTAGGATTAACGAGCGAATGCACAGGAGACTCGGCTAATTTGTCACGGCCAGTCGCGTAG
Protein
MRSYKLEILGISETRWKGFGEHQEDDMTFIYSGKDITDNHESGVGILMTTNAKSSLLDWHPVSDRIIMARFYSRVRNISVIQCYAPTNAASSVTKAKFYSHLQSTLQKIKRQDIVICMGDFNAQLGSDNTNIEPWLGRHAMGRRSENGDMLIDLCCQNDLIVGGSIFPHKSCHKVTWVSPDRITENHIDHVLISRKWRRSLLDVRNKRGADINSDHHLVVAKIKLKVAKIQRTAKTASRNFDTEKLRNPTTKQNFQDDLRNRTVNISCEEGTIEDHWESVRGAFRESCQSVLGYKCTPKKKWISGTTWDMIQARQQKKEQINSAQTLEAKEELAYEYYICESKIKLNLKKDKRAWTEAIAQKAELAAYSGNMSELHKSAKILCNKPIADKPLRDDAGNLLVTLEQQLVGWREHFAKVFEARPTATIVGHEPSQKLLDIEVGPPVVTEIKKAITSLKSGKAPGGDGITAEEMQCEVFTLFIDFEKAFDSVSWSSIWTVLKKKGVPDKLINVIKALYYGSSCRVLHRGKLTDNIVVTAGVKQGCLLSPLLFIMVLDVVMRRVTYDLVDEAEKAGLRINFSKTKEMRINTTDSAPMSIKGRHIERVGSFCYLGSIVDDRGGTEADIAARINKARAAFSQLRPVENETIGVTIYGVGLTSECTGDSANLSRPVA

Summary

Description
Non-catalytic subunit of the queuine tRNA-ribosyltransferase (TGT) that catalyzes the base-exchange of a guanine (G) residue with queuine (Q) at position 34 (anticodon wobble position) in tRNAs with GU(N) anticodons (tRNA-Asp, -Asn, -His and -Tyr), resulting in the hypermodified nucleoside queuosine (7-(((4,5-cis-dihydroxy-2-cyclopenten-1-yl)amino)methyl)-7-deazaguanosine).
Cofactor
Zn(2+)
Subunit
Heterodimer of a catalytic subunit and an accessory subunit.
Similarity
Belongs to the queuine tRNA-ribosyltransferase family. QTRT2 subfamily.
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF00069   Pkinase
PF03372   Exo_endo_phos
PF01702   TGT
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR027124   Swc5/CFDP2       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR000719   Prot_kinase_dom       
IPR017441   Protein_kinase_ATP_BS       
IPR011009   Kinase-like_dom_sf       
IPR036511   TGT-like_sf       
IPR028592   QTRTD1       
IPR002616   tRNA_ribo_trans-like       
SUPFAM
SSF56219   SSF56219        + More
SSF56112   SSF56112       
SSF51713   SSF51713       
Gene 3D
PDB
1AKO     E-value=0.00233562,     Score=99

Ontologies

Topology

Subcellular location
Cytoplasm  
Length:
670
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.92385
Exp number, first 60 AAs:
0.00037
Total prob of N-in:
0.00070
outside
1  -  670
 
 

Population Genetic Test Statistics

Pi
287.595399
Theta
183.303809
Tajima's D
1.195749
CLR
17.243949
CSRT
0.710064496775161
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号