SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07736
Annotation
PREDICTED:_uncharacterized_protein_LOC103515293_[Diaphorina_citri]
Location in the cell
PlasmaMembrane   Reliability : 2.879
 

Sequence

CDS
ATGTATGGTAACTCGTCGCTAGCAGTATCAAGCTCGGAGCACTCGCATGGTCGAACTCACGCTGGCGGCACCGCACGTTGTACGACACATCTCGCGCGTCCGACGTATTCACCCGCGCTTCCCGCCGCTGCTGTCGCTGCCGCTCGCACAGACAGCTCCGCAGCTATCAACTCGGACGGCAACACAAATGACGTCACATTATGCTCGCTGTCTTCCGCTCGCTTACCTACAACTGTTTTGCTTGCGACCGCTCGAGTTGTAATGGTTGATACTTATGGCAAACCGCATCTTGTTCGCGCCCTTTTAGATAGCGCCTCACAGAGTAATTTTATTACTCGTGAATGTTGTCAACGCCTTGGATTAAAATATAGTAACCAGCCTACGTGCCCCGTAGTCAAGGGCATAGGGGGGTCTACTAAGGACATCCAAGGGTCCGTAAAAATTAAATTTGAATCACGTTTTAGCTCGAATGTTTCATTCGAAATAAACTCGCTGGTTGTAGATAAAGTAACGGAGCAACTTCCTACTGTTTCTGTAGATACCTCGTTGTTAGCTAACTTTGATAGTTTGCCGTTAGCCGATGATACTTACGCCGTTCCAGGAGCCGTCGATATTTTGATTGGCGCTTCGATTTTCCCGCACCTCCTGCTGCCACGTAAGGTTCAAGGTCATTCGGCGAACCCCGCACCGCACGCTTTGGAAACTGTTCTCGGTTTTGTTATAGTTGGATCCGCACCCGCTCTTATAAATAGTTACTCGACCGTATCATACTGCTGCGCCGTCGAGCCGCCACTGGACTCCACCGTCCGCCGCTTTTGGGAAATTGAAGAAGTAAATGTTCCGCTGGTTATGAGTCCTGATGATAAGACCGCTGAGGATATTTATTGTAGCACGACCACCCGCGATGAAAGTGGTCGTTATATTGTTGCACTCCCGTTTAAGGGTGATACCTTTTCGCTTGGTGATTCGCGCCTAATGGCCGAAAAACGCTTTTTTTGTTTAGAACGTAAGATGATGGCATCTCCGAAGTTGAAAAAGGCCTACGACGATGTCGTGAATGAATATGTAGATAAGGGTATCATCTCACCTGCTCCCGCTGTACTTGATGAGACGCAAAATGGTCCCTCTTATGTCATCCCGCATCATGGTGTCATTAGGGAGGATAAACTCACCACAAAATTGCGTGTTGTTCTGGATGGCAGTGCTAAGACTAGTACTTCTGTTTCTCTAAACGACATCTTGTATTGTGGTAAAAATCTTCAAGGTAACTTGTTTGATATTATCGTCAATTTTCGTTTATTTATTGTAGCGCTATCTGCAGACATTAGACAAATGTTTCTTTGTATTGGCATTCGGGAATCGGATCGTAGATTCCAAAGATTTTTATATAGGTTTTCCCCACACGAACCATTAAAGGTTTACCAGTTTAACCGCGTTTGTTTCGGACTTAAGTCAAGTCCGTTTCACGCGCTTCGCACTGTGAAGCAGTTAGTTCTTGATGAGGGTGATTCCTACCCCAAGGCAAAAGCTACCATCAATACTGGTCTGTATATGGATGACTTTGCTTATAGTGTAGATAGCGAGCCTGAAGCCATCGAAACAGCTACTCAAGTGATAAGCCTAATGAAGACTGGGCAATTTGACCTTGTTAAGTGGACGAGCAACTCTCAACGTGTTTTGGACTGGATTCCGCCATCGCATCGTCTATCGACGGTTAAGGATTTTGATGTCAATGATACACATAAGATTCTCGGCTTGAGCTGGTCTCCCACATCCGATACATTCAGTCTCAAAATTAGCTCGACCCCGCCAACTTGTACCAAACGCACCATATTGTCTTGTGTCGCTCGCATATGGGACATTATGGGTTTTGTAGCACCTGTAGTGTTATACGCAAAGCTTCTTATTAAAGAGCTTTGGCTTTCTCAGTGTGACTGGGATGACATCGCACCGGACAACGTGGCCAGATTATGGGCTCGCTTCAGGGAAGAGCTTCCTATGCTCGAACATATAGAAATCCCACGTCATGTAGGTATCTCTCGAGATAGTGTAGTCACAATAGTGGGGTTCGCAGATGCTAGTGAGAAGGCTTATGGAGGAGTGGTGTATTTTCACGTTTGCAATGGCGACAATATTACAGTTAGCCTTATTAGTGCGAAATCTAAGGTCTCCCCTCGAAAGGTCGTCTCTCTCGCGCGCCTTGAGCTTTGCGCTTTACTACTATTGACGCGGCTCATTGGTGCCATAGTCAAGGGTTGTAACAACCGCATTAATATTGATAGAATTGCTGGCTTTTCTGACTCAACCGTAGCTTTGTGTTGGGCTCACTCTTCTCCCCACCGTTGGGACACATTTGTTGCTAATAGAGTAGCAAAAATTCAATCTGAATTATCACCTCAAAATCTATATCACGTCGCTGGAACAGACAATCCTGCCGATTGTCTTTCACGGGGTTTAACCCCCGCTCAAATATTAGATCATCCGCTCTGGTTTCATGGTCCGTCATGGATTTTCCTCAATTAG
Protein
MYGNSSLAVSSSEHSHGRTHAGGTARCTTHLARPTYSPALPAAAVAAARTDSSAAINSDGNTNDVTLCSLSSARLPTTVLLATARVVMVDTYGKPHLVRALLDSASQSNFITRECCQRLGLKYSNQPTCPVVKGIGGSTKDIQGSVKIKFESRFSSNVSFEINSLVVDKVTEQLPTVSVDTSLLANFDSLPLADDTYAVPGAVDILIGASIFPHLLLPRKVQGHSANPAPHALETVLGFVIVGSAPALINSYSTVSYCCAVEPPLDSTVRRFWEIEEVNVPLVMSPDDKTAEDIYCSTTTRDESGRYIVALPFKGDTFSLGDSRLMAEKRFFCLERKMMASPKLKKAYDDVVNEYVDKGIISPAPAVLDETQNGPSYVIPHHGVIREDKLTTKLRVVLDGSAKTSTSVSLNDILYCGKNLQGNLFDIIVNFRLFIVALSADIRQMFLCIGIRESDRRFQRFLYRFSPHEPLKVYQFNRVCFGLKSSPFHALRTVKQLVLDEGDSYPKAKATINTGLYMDDFAYSVDSEPEAIETATQVISLMKTGQFDLVKWTSNSQRVLDWIPPSHRLSTVKDFDVNDTHKILGLSWSPTSDTFSLKISSTPPTCTKRTILSCVARIWDIMGFVAPVVLYAKLLIKELWLSQCDWDDIAPDNVARLWARFREELPMLEHIEIPRHVGISRDSVVTIVGFADASEKAYGGVVYFHVCNGDNITVSLISAKSKVSPRKVVSLARLELCALLLLTRLIGAIVKGCNNRINIDRIAGFSDSTVALCWAHSSPHRWDTFVANRVAKIQSELSPQNLYHVAGTDNPADCLSRGLTPAQILDHPLWFHGPSWIFLN

Summary

Similarity
Belongs to the G-protein coupled receptor 1 family.
EMBL
GBBI01004276    JAC14436.1    GEZM01054789    JAV73399.1    GBHO01005525    JAG38079.1    + More
GEZM01054766    GEZM01054765    JAV73410.1    JAV73413.1    ABLF02008594    GEZM01085145    GEZM01085143    JAV60187.1    GGMR01017890    MBY30509.1    ABLF02012239    ABLF02012241    ABLF02017372    ABLF02042178    ABLF02066436    GALX01004947    JAB63519.1    ABLF02030854    ABLF02067347    ABLF02006304    ABLF02036268    ABLF02066034    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    GEBQ01015458    JAT24519.1    GEBQ01000825    JAT39152.1    GEBQ01028569    JAT11408.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GGMR01002421    MBY15040.1    ABLF02030698    ABLF02030705    ABLF02030709    LBMM01012238    KMQ86334.1    ABLF02036131    ABLF02041527    ABLF02064049    ABLF02041863    LBMM01009202    KMQ88311.1    GGMS01010524    MBY79727.1    GBHO01039838    GBHO01006034    JAG03766.1    JAG37570.1    GBHO01027036    GBHO01010996    GBHO01010995    GBHO01010993    GBHO01010991    JAG16568.1    JAG32608.1    JAG32609.1    JAG32611.1    JAG32613.1    ABLF02035780    LNIX01000069    OXA36894.1    GDHC01014057    JAQ04572.1    LNIX01000007    OXA51795.1    LBMM01009888    KMQ87813.1    LNIX01000016    OXA46198.1    GBHO01008418    GBHO01008416    JAG35186.1    JAG35188.1    GEZM01060254    JAV71154.1    GFTR01008874    JAW07552.1    GECZ01008071    JAS61698.1    LBMM01011283    KMQ86917.1    KK114194    KFM61875.1    GGFL01005358    MBW69536.1    GBHO01044316    JAF99287.1    GFTR01008866    JAW07560.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    LBMM01009551    KMQ88039.1    GGFL01004049    MBW68227.1    ABLF02005684    KQ458473    KPJ05885.1    DNYX01000039    HBK82233.1    LBMM01007770    KMQ89434.1    GBHO01006408    JAG37196.1    GALX01000776    JAB67690.1    LNIX01000002    OXA59522.1    GBHO01007689    JAG35915.1    GBRD01007977    JAG57844.1    OXA51382.1    GBBI01004408    JAC14304.1    ABLF02025958    GBBI01004410    JAC14302.1    JXUM01113346    KQ565681    KXJ70776.1    LBMM01009645    KMQ87967.1    LBMM01008464    KMQ88855.1    GGMR01018294    MBY30913.1    AXCM01013330    LBMM01009688    KMQ87939.1    GBHO01031928    GBHO01031926    JAG11676.1    JAG11678.1    GEZM01066274    JAV68017.1    LNIX01000044    OXA38660.1    LNIX01000074    OXA36769.1    GBHO01000060    JAG43544.1    LNIX01000003    OXA58579.1    GBHO01034255    GBHO01034254    JAG09349.1    JAG09350.1    GBBI01004211    JAC14501.1   
Pfam
PF00665   rve        + More
PF05380   Peptidase_A17
PF18701   DUF5641
PF17921   Integrase_H2C2
PF05585   DUF1758
PF03564   DUF1759
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF00001   7tm_1
PF02145   Rap_GAP
Interpro
IPR008042   Retrotrans_Pao        + More
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR005312   DUF1759       
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR001995   Peptidase_A2_cat       
IPR041373   RT_RNaseH       
IPR001969   Aspartic_peptidase_AS       
IPR041577   RT_RNaseH_2       
IPR013087   Znf_C2H2_type       
IPR000727   T_SNARE_dom       
IPR017452   GPCR_Rhodpsn_7TM       
IPR000276   GPCR_Rhodpsn       
IPR000331   Rap_GAP_dom       
IPR035974   Rap/Ran-GAP_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
SSF111347   SSF111347       
Gene 3D

Ontologies

Topology

Length:
840
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.495180000000001
Exp number, first 60 AAs:
0.0004
Total prob of N-in:
0.00154
outside
1  -  840
 
 

Population Genetic Test Statistics

Pi
247.876543
Theta
21.632952
Tajima's D
-0.9312
CLR
0.122793
CSRT
0.149442527873606
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号