SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07714
Pre Gene Modal
BGIBMGA001269
Annotation
PREDICTED:_phosphatidylinositol_4-phosphate_3-kinase_C2_domain-containing_subunit_alpha_isoform_X3_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.546 Nuclear   Reliability : 1.402
 

Sequence

CDS
ATGGTGTACGTTATCAACGGCGGCGAGCGCCCGACGCAGCGCTTCCAGCACTTCGTTGAGCTGTGCTGCATGGCCTTCAACATAGTGAGGGCGCATCACGACCACATCCTCGACCTCTTCGCTTTGATGTCGCTGTCGGGCGTGCCGGGCGTCACCAGCGCCGCCGTGAGCTACGTGCGCGCCGCGCTGCTGCCCGCCGCCAGCAAGGCCGAGGCCGCCGCCGCCTTCGCCAGGCTCATACACTCCTCGCTCAAGAGCAAGTACGGACACAGCCATTACCACTTGAGACTTTTACCCAAGAAAAACGAAGAAGAAAAAATCCCTTACAAGAAAGTGTTATTGAATGGAACAGAGATGGTGGCTTTGATCGATACAGGTAGTGACGCGAATCTTATTAAACATTCAGAATTTGAAAAAATTGAAAATAATATCCAACATTATGACAAGAATTCAGAAGTTCGTCTTACTGGTATTGCTAACAAAGAAATACTTATCAAAGGTGTTTTTACTACTCAGCTACAGATTGATGATGCTGTTACGGATATCAAATTTTACATTGTGGAAGATGATATAATACCTGTAAAGCTGATCATTGGCAACCCCATACTGCGTGAATTCGAAGTTAAGTTTACAAGAAATGGTATTTTAATGGAGAAGATTCCACTTTGTGCTATTGTTGTTGAGAAGGACGAGGTCAAAGAAGACTACAAGAAATTAAAAAAAGGAGATTACAAGAAGTTAGAGAAAGAAGATTACAAGAAGTTAGAAAAAGAAGACTGCAAGAAGTTGGTTAAAGTACCTTACCAGAATCATTTGACACAAAATAGAATACTGTACAAAGAGAAGAATGGAAGTAGTTTTATCGCTGTACCAAAGAAGATGGATAAAGAAATTAGAAGACAGAATTATAGGAGAGGTCGACTAAAAGTTGAAGATTGGGAATGGAGGAGATTTACCCCCATCAATTTCTTCCTGCACAACTTGGCCCAGTTGCGCGCGAGTGGCGACCAAAGCAGCAACACTTCGGAACTGTTGTCATTCATGCCGCGAACGTACAGCATGACCCAAGAGGGGCGGCTGGTGAGCGTGGAGTGCCTGGGCTACGAGAAGCGCTACGACCCGGAGAAGCACTACGTGTACGCGCTGCGCATCTACCGGCTCGGCCAGGCCACGCCCTCCGTGCTCTACCGCTCCTACAAGCACTTCACCGAGCTCTACCAGAAGATCTGCCTGCACTTCCCGCTCGCTAAAGTGCACAGCTTACCGTCCGGCCTGCACGTTGGTCGCTCGAACACTCGGCAAGTCGCCGAACGTCGCTTCGGTGATGTCCGGGCCTTCCTGACCTCACTGTTCAACCTGGCTGATGAGATAGCTCACTCCGATCTAGTGTACACGTTCTTCCACCCGCTGCTCAGGGATCAACAGGACGTGGAACCTCAGAGGTTGAGAAAAGGCGAGAGCACGGAGCCGGAGAGCAGCGGGTCGGGCTCGCTGAAGGTGTCGGTGCAGTACGCGGGCGGCGTGCTCTCCGTGCTCATCCTGCACGCGCAGTCGCTGGCGCTCACGCCGCAGGGGGCGCCGCCCAACCCCTACGTCAAGGTGTACCTCGTACCGGACCCTACGAAGGAAACGAAACGCAAGACCCGCGTTCTAAAGCGCAACTCGCACCCGTCGTTCATGGAGATGCTGGAGTACCGGCTACCGATCGAAGCGGTCAAAAACCGAAGTCTCCAAGCCACAGTCTGGCACTACGATTCGCTGCAAGAGAACCAGTTCTTGGGCGGGGTCGTCATACCGCTGAGCTCGCTGCCCCTCAGACAGGAGACGGTGGCTTGGTACCCGTTGGAGTACATACCCCGGTAG
Protein
MVYVINGGERPTQRFQHFVELCCMAFNIVRAHHDHILDLFALMSLSGVPGVTSAAVSYVRAALLPAASKAEAAAAFARLIHSSLKSKYGHSHYHLRLLPKKNEEEKIPYKKVLLNGTEMVALIDTGSDANLIKHSEFEKIENNIQHYDKNSEVRLTGIANKEILIKGVFTTQLQIDDAVTDIKFYIVEDDIIPVKLIIGNPILREFEVKFTRNGILMEKIPLCAIVVEKDEVKEDYKKLKKGDYKKLEKEDYKKLEKEDCKKLVKVPYQNHLTQNRILYKEKNGSSFIAVPKKMDKEIRRQNYRRGRLKVEDWEWRRFTPINFFLHNLAQLRASGDQSSNTSELLSFMPRTYSMTQEGRLVSVECLGYEKRYDPEKHYVYALRIYRLGQATPSVLYRSYKHFTELYQKICLHFPLAKVHSLPSGLHVGRSNTRQVAERRFGDVRAFLTSLFNLADEIAHSDLVYTFFHPLLRDQQDVEPQRLRKGESTEPESSGSGSLKVSVQYAGGVLSVLILHAQSLALTPQGAPPNPYVKVYLVPDPTKETKRKTRVLKRNSHPSFMEMLEYRLPIEAVKNRSLQATVWHYDSLQENQFLGGVVIPLSSLPLRQETVAWYPLEYIPR

Summary

Uniprot
ProteinModelPortal
PDB
6BUB     E-value=5.55592e-30,     Score=329

Ontologies

Topology

Length:
620
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.57175000000001
Exp number, first 60 AAs:
2.50999
Total prob of N-in:
0.11139
outside
1  -  620
 
 

Population Genetic Test Statistics

Pi
217.639824
Theta
157.532466
Tajima's D
0.920252
CLR
0.59897
CSRT
0.629918504074796
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号