SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07692
Annotation
PREDICTED:_uncharacterized_protein_LOC106105849_[Papilio_polytes]
Location in the cell
Nuclear   Reliability : 2.573
 

Sequence

CDS
ATGTCTGATCGAAGTAAGCGTAGGAAGCGCGAGCGTGATCGTACACCTATCCCTGGTATGGAGAAGCGACTTCAAAAGATTTTGGATCGTTTAGACACTTTAGAAAGTTACAGGTTTCGCAATGATACTGAAGGTAGTACGACAACGCCGAGTGCGCGGTGGGCGCATGACGGCGCCATCGCGGCGGCAGCTGTCGCGTCGGGTGAGCCGCCTGCACCAATTGCTGTTTCAACAAACGTCGAGTCGTCCGATGCAAGTTTGAATTTATCCGTGCCGTGCTCGAGTGCGACGATCAACGGTTCGGGTACGGGCGTATTGAATGAGGTGGCTGAGAAAATTGCTAATGCGATTGGTGCAATTCCGGTAAGATCGAATCATATTTTTGTGTCGAGTTTCGATCCCTCTTTGCACGATTTTAATTTATGGTGTCATGAAGTAGACCATCTAAAACAAACTAATAGATGGGACGATCTTGAGTGCTTAGCGAGGGTAGGCAATTGTTTAAAAGGTGACGCTAAGTTATGGTTGAATGAGTGGGTAAGTAATGACCGTAGTTGGTCAAATTTCAAGCGCGAGTTTAAGACTTTGTGTCCCAAGCGGTTAGACATCGCCAATATTTTGTTCGACATTATGAAATCGGACTCTGATAACTACCCTACATATGCCGAATATGCAAGGCGTTCGCTTCTGCGGTTACGTATTGTGAACGGATTGAGTGACGAGTTAATTGCGGCAATAGTGATACGTGGCATAACAGACACTCAAATTCGAGCCGCTACCACTAACGCCAAGTTACTGCCTGATGATTTGGTTAATTTTCTATCTATTTATACAAAGCCCACTAGAATCACATCCGTTTGTTCAACCGATTTAATTTATAAGACTGCTACGAGAAAACGAGAACATGTCGTCACGAAAATTTAA
Protein
MSDRSKRRKRERDRTPIPGMEKRLQKILDRLDTLESYRFRNDTEGSTTTPSARWAHDGAIAAAAVASGEPPAPIAVSTNVESSDASLNLSVPCSSATINGSGTGVLNEVAEKIANAIGAIPVRSNHIFVSSFDPSLHDFNLWCHEVDHLKQTNRWDDLECLARVGNCLKGDAKLWLNEWVSNDRSWSNFKREFKTLCPKRLDIANILFDIMKSDSDNYPTYAEYARRSLLRLRIVNGLSDELIAAIVIRGITDTQIRAATTNAKLLPDDLVNFLSIYTKPTRITSVCSTDLIYKTATRKREHVVTKI

Summary

Pfam
PF04756   OST3_OST6
Interpro
IPR036249   Thioredoxin-like_sf        + More
IPR021149   OligosaccharylTrfase_OST3/OST6       
SUPFAM
SSF52833   SSF52833       

Ontologies

Topology

Length:
307
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.17347
Exp number, first 60 AAs:
0.00078
Total prob of N-in:
0.40475
outside
1  -  307
 
 

Population Genetic Test Statistics

Pi
363.480165
Theta
166.525531
Tajima's D
0.861159
CLR
1.109508
CSRT
0.627618619069047
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号