Gene

KWMTBOMO07676

Pre Gene Modal

BGIBMGA000862

Annotation

PREDICTED:_centromere-associated_protein_E-like_isoform_X1_[Amyelois_transitella]

Location

Bomo_Chr13(+):4308171-4341021      View in EpiBrowser

Full name

Centromere-associated protein E       + More
Kinesin-like protein KIN-7L      
Kinesin-like protein KIN-7I      
Kinesin-like protein KIN-7O      
Kinesin-related protein 4      
Kinesin-like protein KIN-7N      
Kinesin-like protein KIN-7L, chloroplastic      
Kinesin-like protein KIN-7K, chloroplastic      
Kinesin-like protein KIN-7E, chloroplastic      
Kinesin-like protein KIN-7D, chloroplastic      
Kinesin-like protein KIN-7D, mitochondrial      
Kinesin-like protein KIN-7C, mitochondrial      
Kinesin-like protein KIN-7M, chloroplastic      
Kinesin-like protein KIN-7G      
Kinesin-like protein KIF3B      
Kinesin-II 95 kDa subunit      
Kinesin-related protein 11      
Kinesin-like protein KIF3A      
Kinesin heavy chain      
Kinesin-II 85 kDa subunit      
Osmotic avoidance abnormal protein 3      
Kinesin heavy chain isoform 5C      
Kinesin-like protein FLA10      
Kinesin-like protein KIN-7A      
Kinesin-like protein KIF3C      
Kinesin-like protein KIN-7J      
Kinesin-like protein KIN-7E      
Kinesin heavy chain isoform 5A      
Kinesin-1 heavy chain      
Kinesin-like protein KIN-7C      
Kinesin-like protein NACK1      
Kinesin-like protein KIN-7H      
Kinesin-like protein KIF17      
Kinesin-like protein KIN-7F      
Kinesin-like protein KIF15      
Kinesin-related protein 3      
Kinesin-like protein KIN-7B      
Kinesin-like protein KIN-4A      
Kinesin-like protein Klp68D      
Chromosome-associated kinesin KIF4      
Kinesin-like protein NACK2      
Chromosome-associated kinesin KIF4A      
Chromosome-associated kinesin KIF4B      
Kinesin-like protein KIF15-B      
Kinesin-like protein KIN-4C      
Kinesin-like protein 3      
Kinesin-like protein KIN-5C      
Kinesin-like protein klp-20      
Kinesin-like protein KIF27      
Kinesin-like protein Klp98A      
Kinesin-like protein KIF15-A      
Kinesin-like protein KIF11-B      
Kinesin-like protein KIN-5A      
Kinesin-like protein KIF11-A      
Kinesin-like protein KIN-12G      
Kinesin-like protein KIF11      
Kinesin-like protein KIF18A      
Kinesin-like protein KIN-12E      

Alternative Name

Centromere protein E
Kinesin superfamily protein 10
Motor domain of KIF10
Kinesin-7
Kinesin-related protein CENPE
Kinesin family member 4
Mitochondria-targeted kinesin-related protein 2
Mitochondria-targeted kinesin-related protein 1
HH0048
Microtubule plus end-directed kinesin motor 3B
KRP-85/95 95 kDa subunit
Kinesin family member 11
Microtubule plus end-directed kinesin motor 3A
KRP-85/95 85 kDa subunit
Synkin
Kinesin-like protein osm-3
Kinesin heavy chain neuron-specific 2
Protein KHP1
NPK1-activating kinesin-like protein
Protein DWARF BAMBOO SHOOT 1
Kinesin heavy chain neuron-specific 1
Neuronal kinesin heavy chain
Conventional kinesin heavy chain
Ubiquitous kinesin heavy chain
Uncoordinated protein 116
NPK1-activating kinesin-1
KIF3-related motor protein
Kinesin-like protein 2
Kinesin-like protein 7
Serologically defined breast cancer antigen NY-BR-62
Kinesin family member 3
Kinesin-1
NPK1-activating kinesin-2
Protein STUD
Protein TETRASPORE
Protein HINKEL
AtKINESIN-4A
Protein FRAGILE FIBER 1
Chromokinesin
NPK1-activating kinesin 2
Chromokinesin-A
Chromokinesin-B
Kinesin-like protein 2-B
Kinesin-related protein KRP180
Chromosome-associated kinesin KLP1
AtKINESIN-4C
Kinesin-related protein 1
125 kDa kinesin-related protein
Kinesin-like protein 2-A
Kinesin-5
Kinesin-related motor protein Eg5-1
AtKRP125c
Protein LOOPHOLE
Protein RADIALLY SWOLLEN 7
AtKRP125b
Kinesin-related motor protein Eg5-2
Protein BRITTLE CULM 2
Protein GIBBERELLIN-DEFICIENT DWARF 1
Kinesin-like protein 1
Kinesin-like spindle protein HKSP
Kinesin-related motor protein Eg5
Thyroid receptor-interacting protein 5
Costal2

Location in the cell

Nuclear   Reliability : 3.6

CDS

ATGAGTGATAATATCAAAGTGGTTGTCAAAGTTCGGCCTTTGATTACAAGGGAAATTGAAGAGAAACTCCCTTACCAGTGGCGCATTAAAAATAATTCCCTATATCAACTAGATCAGAATGGCAAAGAGTTCGGATCTTCATTTACATTTGACAAAGTTTATGATGAAAGTACAAAAACCAGTGAAGTTTACAATGATATTGCAAAGCCTATCGTTGAAGCAGCAGTTGCTGGATTCAATGGTACTATCTTTGCATACGGGCAGACCTCCTCCGGGAAGACTTACACTATGGCAGGAACTGAGAGCTCGCCGGGTATAATAACATTAGCTGTTTTAAACCTATTTGAAATTATCAAGAATATACCTGACCGTGACTTTTTAGTAAGAGTATCTTACATAGAAATCTATAATGAAACTGTAAAAGATCTTCTTAACATTGAAAAAGACAACATAAAGATCCATGACACTTTACAAGGTATTAAAGTGGATGCAACTGAGAAAGTCACTTCCTCGCCTGAAGAAGTACTGGAAATTATAAAACAGGGTGAAGCAAATCGGCAAACAGGGTCAACAAATATGAATGAGAAAAGTAGCAGATCACATTCTATCTTTCAAATAACTATTGAATCTAAAGAACATGTTGAAGGTAAAGAGGAGGTTGGTAGCGTTAACGTATCACAGCTGAATCTAGTTGATCTTGCGGGCTCTGAACGTGCAGGACAAACAGGTGCTAAGGGCTTACGTTTTAAAGAAGGAACCCATATTAATAAATCGCTGTCTGCCCTTGCTTTGGTCATCAAAAAACTTGCTGAGAATCCTGGGCAGTTCAACAACTACCGTGACAGCAAATTAACAAGAATACTACAGAACTCACTCGGTGGGAATGCTAAAACAAGTATCATATGTGCAGTTACACCAGCTGCTCTAGAAGAAACAATTTCTACCTTACAATTCGGAAACCGTGCGAAATTTATAAAGAACGAACCTATTTTGAATGAAGTACAGAGTAACGCTACAATGATCCAGCAGTTAACTAAGAAACTTGGGGCCCTCCAAACTGAACTTGAATGCAAGAAACATCTTGAGCAAGACAACTACAACCTCCAGAAACAGATAGCGGGATTACAGAGGCTAATATTAAGTGGCGTAACGCGACATTCTACTGAAGACATCATCAGCACCCGTCGCAAACATCCTCAACGCAGGATTACAATATCGGCTTTGCACTCGGTCGAAGAATCCACAACTAGCATCCCGAGGTTTTGTACTCCTGTCTTGAAATACAACCCGATGACGTTAGGCGGTTGTTCATCAGACTTAGCTCCGTTACAACGTCCGGGAACCTTATCCACTGTTCCTGAAGAAACTTCACGGATGGTCACCCCGCCCCCTGGTGACAAGAGAGTCAACTTTGAGGATGAAATCATCGAGCTCGATAGCGACGATGACGAAGTAGCAAATAATCAAACTTGTTCACCTATTCATGAATGCTATGACAAATCGAAGACGCCTCCTTGTGTACTGAGGAAGACAGCGAAACGAGCCGAGAAGAATCTCAAAGACATAGTCGAGTTAACTGAACGAGAGAAAATTTATCCTCCTAGAGTTGCGGAATTGTTGGAGAAATTGGAAGAAAAAACTTATGCTATTACGATGCTACAAGACGAGATGGAGACTTTCAATAAACAGAGTAAAGAAAAAGATCTACAGATGGAATATATGAAGAAGAAAATCCAAAAATTAGAAGACACAATTGTTAATGTCACTTCGGAAAAGGAAAAATTAGAAACCCGTTGCAAAGATGTTGACATCAAGCTAACGGACTGGGAAGTTAGCTACGACACTTTCAAGAAAAAAGCGAAACAAAGAGAAGAAGAATTGCTTTCGATAGTAGAAGAACTGAAAACTAAATCACATACAGGAGGTATATCCCTAAATCAAAGTCTCAAAGAGCAATCGATTTTAAAATGTCCAGAAATCAGTACAAATAAAGAAGATGAATCTTCAACCCCAAATTTAGTCTCAGACTTACAGTCACAACTGGTCGTCAAAAACCAAACTATCGTAGAATTACAGGCGGATATCTGTGCACAAAATCAAACGATCACGTTCTTAGAAAAATCTAGTCAAGAATTACAAGACATGATAAACAATTACAAGGAAAATCTAACAGATAAAGATGAAGAAATTGGATTGCTTAAATGTGCCATAGAAACATTAAATTCGACTATAAAAAGCCAAAAATCTTGTCTAGATACTGCAAACGACGACATTAAATCCTATAACAGTGTTATACAGGAGTTACAAATAAAACTCACCGGTAAAGAGACCCAATTAAATTTAAACATAGAAGACGATCTTTTGCAAAACATGATTGACAATGAAGCAACACTATTTGCCAACAACGAAAACATTAGAAACATAATACACGCTTTCAAAATTAGACTTGAAGAATGCTATAAGGAAATTGGCCAATTAAAATCTGGTTTACAACAAAATGTTGGCGTTGGAGACAAAACTGTAGCAGAACTAAAAAATGATGAAATTAATAGCATGATTCGTCAGTTGGAAGAAGAGATTGAGAAATGTAAAATAGTCGAGGAAGAACTCACCGAAAAATTAACAATAGCAGAAACTAAACATAATGATTTGAAAAAATTGTATGAGGATAGTGCATCAGAATTGGAAGCATTAAAAAGAGAAAACATACAAATGCATACAAGTGAGGGTGAATCAAAAAAAGTAGTCGAACAATTATTGGAAAAAAATATAATATTAACAGATGAAATAGATGCCATGACCAAGAAAATCACAACATTACAAGAGAACATTAGTTCAAAAGAAATAATAATAGAATCTTTACAAGAAAACAATAAAGACAGAATGGAATATTTAGATAAAGCTAAATTAATCATTAAAAAACTTCAAGATGTTTTCTTAATTTTATCAGGTGATGTCATGGTGGTTCCAGAAATTATTGATAGTTTAACAGAAGTAATCAATACGTTGACTAACGGTTTTGAGTCTTTAGAAGAAGTAGCACTAGAAATAGACTTAAAGAAAAATTCAATAACAAAAGATAATATATCCATAAAGACCTTGTTAGATAAATTAATAACCAAAAATGAAACAGACATTAATGAGTTAAGGAACTCTATAAAATATCTTGAAAGTGTAAAAAGTGAATACAATACTGCTAACGAAAAGCTTTTTGAACAGTTAAATAATGCAGTAGATAAACAAAATTGCATTCAGGAAGAAGTGGATTTATTAAAAATTGAAAATCAAAATCTATTACAAGAATTACTATCTCGTAAAACAGAACTAGAAAAATTGGAGTTAGAAATATTAGCCCGCGACAAATTTATTGCAAATTTAGAAGAAATGAAAACTATGCTCGTCGAGGAGAAGCTGTCAGAAATTAAAGAGAAGGACGAAAATTTCAAACAAGAAATTGATATGTTGAATGAAAAGTTAATCTGTGATCGACGTGAATTTAATGAAACTATGCAAGAGAAAAACATACTACTCTCTGATTTATCTAAGAAAGTCAACAAAACAGAACGCGAGTTAGAAGAGAAACAAGAACAACTTACCCATCTAATGGAGCAACTCAATGACACTGAGAATAACAGTTACAAGCTTATCGAAAATATGTTCAATAAAGTTTCTCAAATCGCATCAGATTTTAAAATTTCCAATCAGCTGTCCTGTGAACTTGATGATGAGAGTGAAAACACATACGAAAGAATTAGTCTAACTTTGGACAAGATAACTAATCACATAACGTATTTAAACACGCAAATAAATGAGACACAGAAGAATGATAATGCGCAGTTATTATGGGAAGCAAAGAAACAGATTGCAGATCTAACGGAACAAAATATCATTTTAAAAGAAAGATTATCACAATTAGAAACAGAAAATAAAGAACTTCTTATTGAAATTCAAACAGTTCGAGGTAGTAATGAAGAAGTAACACTAAATTTAAAAGACAGTAGCACATTGTTGAAACAACTCAAAGAAGAATTGAAACAAAAAAGTAACGAGATAGAAGATATGAAAACTAAAGTGATGGAATGGAAAAGCCAATTCGAGGATTTAGATGACGTGATGAAACAACAACAAAAAGAATTAAAACTGGAAAATAAAAAACTTCATGATAAAAGAACTGAAAAAAGTGCAGAAAGCTTAGATTCTGAAGAGGACGAAGAATGTGTAAACAATTTTTATGAAATAAGCGTGAACACAGACAGTGAAAATACATTAGAGCAATCAGCCTATTCTCCAAAAAGTCTTGTCACAATATGCTGTAGCAAGATTTTAGATAGCATTCAATCGAATGATACCAAAAAAGACATATCGACTTGTGACAAAGACGAGACGACGAAATGCAGCAACTGTGATGAGTTTTCCTCCCAATTGACTTCTGCACAAGATAAAAACGACAAATTGACGCAGAAGGTACAACAGCTACAAGCCTTTAACCTACAACTAATGGACGAACACGAATTAGTTCGTTTAGAACTACAAAAATTAATAGAACCAGCTCATGAATTACAAAAAAAGATTATCAATCATAAAACTAATTTGTCGATACTCACCGCGACAACGTATGCTGAGAATAAACTACTCAATTCTCAGGTTAAGAGTTTACAACATCACCACGGTCGCTTTCACTACGTATGTCAAAGAGATTTGCCAGCGTTTAAAAAGCAATTGTGTGATCTCTTAGCAATCCTAAAAAACTGTCCTACATTAGTCGAATCAGAAAATGGTAGTTTGAAAAGATTTTCCTTGCCAGATGTCTTAGAAAAAAATACAACGATTGCAAGAAACGAATCCGTTTTGGATGGTGATTTATTAATGCTGGATACAAATGTTAGTCTTACAACAGCTGACAGTACCTTGGTAGCCTGCGACCAAACATGTTTAGATTTGACCCAAAACCTAATCAATGAAATCTCTATACAAACTAATTTCAACCAAACTATAGAAGCAAGTGATGTCAATTCTCAAATCGAAATGTTAAATAATGATAACCGAATTATGTTTGAGAAATTAGAAATTTTGAAGGAGGAAAACGAAAAATTACGTAACCAATTAGATGGAGCTAAAAGTAAAAATGACAACATTATAGAAACACAAAGTAATCCAATAAAGTTACAGGATTCCGGAACCATAACAATTTCTTGTAAAATGTGTCAGAGTCTAAAAGAATCTTCAAACGAAATCAATCTAAAACTTGAAAAGCTATCCGGAGAGTTATTCGATATTAAAGAACAAAAGAGTGCTTTGGAGGGTAAATATCAAAATTTAATATTGGAAACACAAACGAGAGATCTACTGATGTCCCAAATTAAGTCCTTAGAAATGGAAAACCTCACTAAAGATAAAGAAATCAAGAACTTAACAGACTCTTTAAAAACTAAAAGTAAAAAAATTAATGAGCTGCAAGAAGAGAATGATACACTTTCCAATCTTATAATGGAAAACGTTACCGAAAGTGATAATTTGAATAAAGAAGTAGACGATCTAAAGAAAAATAATGAATGTCTTACACAAAAATGTATTGATTTGGAAAAACTTGTTAATGAATCCGAAAATAAAATTGGACCTAAAAATATATGTGCTCAATGTAAATTAAAAGAAAATTTAATACAATCTTTACATATCGGTTACGACAACACTCTATCAAAACTGAATCGAAGCATTAGTGACTCTAATACTTCAACACGATACAATAAAATTTGTACACTACAAAGCGAATTGGACGCGGGAAGAGAAGATTGTAAAGAACTCTGCGAAGATTTCACGTCAATAAAGAACCATTTAGAACTACACGAACCTAATATGACCATGGATTTAGATGAAAGTATTGAAAATGCAAACTTTTTACCACAATCAACAGCAAACCTGTCTAAAATCGCTGACGAAAAAAATCTTGACATGTCTTATGTAATGGATAAAACGATGTGCCTAAATTATTATACAGAAATTGTAGGAGTGGAAGATCACGATCTAAAAGAAAATATTAAAATAATTGATGTTATGAAAATGCTGCATAATCATTTGTTAACGAGTCACGGCAATGAAGTTGAAAATCTAGTGAATAAGCTTAAGGATTATGAAGAAACTAAAAATGACTTACTGAACCAGTTGGAGACTACTAGTGCTAAATGTTCAATAATAAACAAAGAACTTGGAGAAAACAATGAATTTGAAACTAAAGCCGTCAAGGTCATGTCCGAAATCAAAAGAAATTTAAATTCCCTTAGCGAACAATTAATAAATAATGAAAGTAAAAAAAGCAAAGATCACATAGACAGATACAAAGATAGCTTACTTGCTGTTCTGGATGCAGAATTCGGAACTACCAGCTTAGATGTATTTGAAATTCTAATGGATAACATAATAAACAAATATCAAATAGACTTAGATGAAATCTTGGAAAAATACACCAAAGTACAAGGAGATTTAAATGAGTGCACTTCGGAACTAAAATCAGTAAACGAAAAATTGGCATCCCTGAATAGTCAATTAATTGAAAAAGAAAACGCCTGTAATATTTTGAGAATACAGAAAGAAAGAATACATGAAATCAGCTCAGCGGTTACAATAGATATTGTTAAGAAAGAAAATGAATTAAAGGAAATACTGACCAAAGAATGTTTGAAACTTTCAAAATTAAAAATAGATATTCCACGCGACTTAGATCAGGACTTACCGGCGCATAAAAAAATTACTATTCTGTTTGATGCTCTCATAACACAGTATGAACTCTCGCGAACGGATTACGAAATCGAAAAGGAAAAACTTAGATTGGAAACTGGTACGGCGAAAGCAGTGTTAGAAGAAAAAGAAAAAGAATTATCTGAACTAAAATTAAAATTCGATACACTCGAAGAGGCGCACAACGAAGTAAAATCATTGCATGAAGAATTAACGAAACTGTACAAGAGTAAAGTAGACGAAAATAATGCGAACTTGAATTTAATAAAAATATTATCCGAAGAAATCGATGCACTTAAAATAGCGATAGCTAAAAACGAAGAAAAAATGCTGTCTCTATCTGAAAAAGACAATAAATTAACGGAGCTGGTCTCTACAATAAACGGCTTAAAAGAAGAAAATAACTCACTAAAGTCGCTCAATGATGTTATAACAAGAGAAAAAGAAACTCAAGCTTCAGAATTGGAAAGGTCGTGTCAAGTAATAAAACAAAACGGTTTCGAACTGGACAAGATGAAAGCAGATATATTGATGTTAAATGAAACTGTCAAAGAGAATACAGTAGTTGTTGAAACTTTAAAAGATGAAGCTAAATCACTGTTGGAGCAAAATCTAGCTTTGAAGGAACAGTGTGAGGAGAAAACGCGCGATTGCTCTCGTCTCGAAATTAACATCAAAACACACGAGAAAACTGCCGAAATCCAAAACAGAATGATCATGAGACTTCAAAAACAGAAACAGGAAGACGATAAACTATTCATAGAGAAAGAAACTAAATTGAACGAACTAACGAACAAATATGAAGCTCTGAAGAGAGATTATGATGCGGCGGTAAAGGATCTCGAGTCAAGCAGAGAAGCGGTGAACCAATTGACTACACAGAAAGATCTTGTTGAGGGTCGTATAGCCGAACTGGAATCTGATATACGAACGGAACAAACAGCAACAGTTTCGCTAGACGACGCGTCCAAGTCGTCCCGGAGCCGCCGCCGCAGTCTGCACGACTCGAAGAGGACGTTTGGCGACGAAAACCGTGACCTGGGAGAAAGCAATTTGGAAGCTGTTTTCGAGTCGCGTCGCCAACCCGACGATCTCTTCATGGATGTAGACGGACACGATTCAAACAGAAGCACACCTATTCGACTCAAAGGACGTGACAGTTTACTAAAATCAGATAATAGCGACGTAGGAGAGGAGCACTCGTCCCGGCCCGGCAGCGTGCAGGCTTCGCGACGGAGGCGACAGAGTATACACGACTTCCACCGGAGTATAATGCGGTCTAGCCGAGATACTTCCCACGAAAATCCAAAACTTGACGATTCCCCAAAGAGGTCAATATCAGTAATCAGTGACAGTGAAGTGTCTCAGCTTAAGGAGCGGCTATTGTCATGTCAACAAGAACTAGACGATCTAAAGGAGAGGTACAAAGAATTGGACGACGAGTGCGAAACCTGCGCAGAGTACTTGCAAGAAAGAGACGAGCAATGCGCTCGCTTGAAAAAGGAAAAATTGAGTTTAGAGCAACAAGTATCAAATTTGAAAGAACAAATACGTACGCAACAACCTGTTGAACGTCAAGCAAAATTCGCGGATGTCGCCGTCAACACAGACGAAGATTGGGCCAATCTACATTCGGTGGTCGTCGATCGAATGTCGTACGACGCGGAGGTCGAAAAGAACAAGAGGCTAATGAAAACCATTGAAGAACTGCGATACAAGAAGCAAGATCTGAAGAATACTGTCACAAAAATGCAAAAAGCAATGGAGAAATATACTAAAAAAGACAAAGAATTCGAAGCGAAAAGGAAAGAGCTGGAGGATTGTAAAGCAGAACTTGAAGAATTAAAACAAAGATATAAGGAGTTGGACGAAGAATGCGAGACATGTGCAGAGTACCTTAAACAAAGAGAAGAACAATGTAAGAGGCTTAAAGAGGCTAAAATCGCTCTAGAGATGAAATTACAAGAGTTCCAAACCGACGCTAGTATAGTACATCTGCAATCCGTACGTAAGAAACGAAGGAGCATACACGATCAGAACCGAGCTTCCAACGTCGATCTTGTGGATGCATCCACACAGATTGGTGACGATTTTCTAAATAATCAAGTTGAACGCGACCGCGGCTCCGGTAACGCAACCGACGAATCTCATGTCCGTGAAATGCAACGACTTCAGAAGATTGTGGACAAGTTAAGCAACCAGAAGGTCGCCTTGGAGAAGCAAATAGAATCTTTGAGTAATACGCCTGTATCGAATTCCACTATGTATGTAGCCACTGGCAGTGCGATAGTGCAGAACCAACAAATAACTGACGTGATGAAGGAAAATCAAAAACTAAAGAAGATGAATGCCAAACTGATTACGATATGCAAGAAACGAGGCAAGACAGGCGCCAACAGAGAGAATGAGGATCCGTCCGATGTTTGA

Protein

MSDNIKVVVKVRPLITREIEEKLPYQWRIKNNSLYQLDQNGKEFGSSFTFDKVYDESTKTSEVYNDIAKPIVEAAVAGFNGTIFAYGQTSSGKTYTMAGTESSPGIITLAVLNLFEIIKNIPDRDFLVRVSYIEIYNETVKDLLNIEKDNIKIHDTLQGIKVDATEKVTSSPEEVLEIIKQGEANRQTGSTNMNEKSSRSHSIFQITIESKEHVEGKEEVGSVNVSQLNLVDLAGSERAGQTGAKGLRFKEGTHINKSLSALALVIKKLAENPGQFNNYRDSKLTRILQNSLGGNAKTSIICAVTPAALEETISTLQFGNRAKFIKNEPILNEVQSNATMIQQLTKKLGALQTELECKKHLEQDNYNLQKQIAGLQRLILSGVTRHSTEDIISTRRKHPQRRITISALHSVEESTTSIPRFCTPVLKYNPMTLGGCSSDLAPLQRPGTLSTVPEETSRMVTPPPGDKRVNFEDEIIELDSDDDEVANNQTCSPIHECYDKSKTPPCVLRKTAKRAEKNLKDIVELTEREKIYPPRVAELLEKLEEKTYAITMLQDEMETFNKQSKEKDLQMEYMKKKIQKLEDTIVNVTSEKEKLETRCKDVDIKLTDWEVSYDTFKKKAKQREEELLSIVEELKTKSHTGGISLNQSLKEQSILKCPEISTNKEDESSTPNLVSDLQSQLVVKNQTIVELQADICAQNQTITFLEKSSQELQDMINNYKENLTDKDEEIGLLKCAIETLNSTIKSQKSCLDTANDDIKSYNSVIQELQIKLTGKETQLNLNIEDDLLQNMIDNEATLFANNENIRNIIHAFKIRLEECYKEIGQLKSGLQQNVGVGDKTVAELKNDEINSMIRQLEEEIEKCKIVEEELTEKLTIAETKHNDLKKLYEDSASELEALKRENIQMHTSEGESKKVVEQLLEKNIILTDEIDAMTKKITTLQENISSKEIIIESLQENNKDRMEYLDKAKLIIKKLQDVFLILSGDVMVVPEIIDSLTEVINTLTNGFESLEEVALEIDLKKNSITKDNISIKTLLDKLITKNETDINELRNSIKYLESVKSEYNTANEKLFEQLNNAVDKQNCIQEEVDLLKIENQNLLQELLSRKTELEKLELEILARDKFIANLEEMKTMLVEEKLSEIKEKDENFKQEIDMLNEKLICDRREFNETMQEKNILLSDLSKKVNKTERELEEKQEQLTHLMEQLNDTENNSYKLIENMFNKVSQIASDFKISNQLSCELDDESENTYERISLTLDKITNHITYLNTQINETQKNDNAQLLWEAKKQIADLTEQNIILKERLSQLETENKELLIEIQTVRGSNEEVTLNLKDSSTLLKQLKEELKQKSNEIEDMKTKVMEWKSQFEDLDDVMKQQQKELKLENKKLHDKRTEKSAESLDSEEDEECVNNFYEISVNTDSENTLEQSAYSPKSLVTICCSKILDSIQSNDTKKDISTCDKDETTKCSNCDEFSSQLTSAQDKNDKLTQKVQQLQAFNLQLMDEHELVRLELQKLIEPAHELQKKIINHKTNLSILTATTYAENKLLNSQVKSLQHHHGRFHYVCQRDLPAFKKQLCDLLAILKNCPTLVESENGSLKRFSLPDVLEKNTTIARNESVLDGDLLMLDTNVSLTTADSTLVACDQTCLDLTQNLINEISIQTNFNQTIEASDVNSQIEMLNNDNRIMFEKLEILKEENEKLRNQLDGAKSKNDNIIETQSNPIKLQDSGTITISCKMCQSLKESSNEINLKLEKLSGELFDIKEQKSALEGKYQNLILETQTRDLLMSQIKSLEMENLTKDKEIKNLTDSLKTKSKKINELQEENDTLSNLIMENVTESDNLNKEVDDLKKNNECLTQKCIDLEKLVNESENKIGPKNICAQCKLKENLIQSLHIGYDNTLSKLNRSISDSNTSTRYNKICTLQSELDAGREDCKELCEDFTSIKNHLELHEPNMTMDLDESIENANFLPQSTANLSKIADEKNLDMSYVMDKTMCLNYYTEIVGVEDHDLKENIKIIDVMKMLHNHLLTSHGNEVENLVNKLKDYEETKNDLLNQLETTSAKCSIINKELGENNEFETKAVKVMSEIKRNLNSLSEQLINNESKKSKDHIDRYKDSLLAVLDAEFGTTSLDVFEILMDNIINKYQIDLDEILEKYTKVQGDLNECTSELKSVNEKLASLNSQLIEKENACNILRIQKERIHEISSAVTIDIVKKENELKEILTKECLKLSKLKIDIPRDLDQDLPAHKKITILFDALITQYELSRTDYEIEKEKLRLETGTAKAVLEEKEKELSELKLKFDTLEEAHNEVKSLHEELTKLYKSKVDENNANLNLIKILSEEIDALKIAIAKNEEKMLSLSEKDNKLTELVSTINGLKEENNSLKSLNDVITREKETQASELERSCQVIKQNGFELDKMKADILMLNETVKENTVVVETLKDEAKSLLEQNLALKEQCEEKTRDCSRLEINIKTHEKTAEIQNRMIMRLQKQKQEDDKLFIEKETKLNELTNKYEALKRDYDAAVKDLESSREAVNQLTTQKDLVEGRIAELESDIRTEQTATVSLDDASKSSRSRRRSLHDSKRTFGDENRDLGESNLEAVFESRRQPDDLFMDVDGHDSNRSTPIRLKGRDSLLKSDNSDVGEEHSSRPGSVQASRRRRQSIHDFHRSIMRSSRDTSHENPKLDDSPKRSISVISDSEVSQLKERLLSCQQELDDLKERYKELDDECETCAEYLQERDEQCARLKKEKLSLEQQVSNLKEQIRTQQPVERQAKFADVAVNTDEDWANLHSVVVDRMSYDAEVEKNKRLMKTIEELRYKKQDLKNTVTKMQKAMEKYTKKDKEFEAKRKELEDCKAELEELKQRYKELDEECETCAEYLKQREEQCKRLKEAKIALEMKLQEFQTDASIVHLQSVRKKRRSIHDQNRASNVDLVDASTQIGDDFLNNQVERDRGSGNATDESHVREMQRLQKIVDKLSNQKVALEKQIESLSNTPVSNSTMYVATGSAIVQNQQITDVMKENQKLKKMNAKLITICKKRGKTGANRENEDPSDV

Description

Microtubule plus-end-directed kinetochore motor which plays an important role in chromosome congression, microtubule-kinetochore conjugation and spindle assembly checkpoint activation. Drives chromosome congression (alignment of chromosomes at the spindle equator resulting in the formation of the metaphase plate) by mediating the lateral sliding of polar chromosomes along spindle microtubules towards the spindle equator and by aiding the establishment and maintenance of connections between kinetochores and spindle microtubules. The transport of pole-proximal chromosomes towards the spindle equator is favored by microtubule tracks that are detyrosinated. Acts as a processive bi-directional tracker of dynamic microtubule tips; after chromosomes have congressed, continues to play an active role at kinetochores, enhancing their links with dynamic microtubule ends. Suppresses chromosome congression in NDC80-depleted cells and contributes positively to congression only when microtubules are stabilized (By similarity). Plays an important role in the formation of stable attachments between kinetochores and spindle microtubules (PubMed:12925705). The stabilization of kinetochore-microtubule attachment also requires CENPE-dependent localization of other proteins to the kinetochore including BUB1B, MAD1 and MAD2. Plays a role in spindle assembly checkpoint activation (SAC) via its interaction with BUB1B resulting in the activation of its kinase activity, which is important for activating SAC (PubMed:12361599). Necessary for the mitotic checkpoint signal at individual kinetochores to prevent aneuploidy due to single chromosome loss (PubMed:12925705).
Microtubule plus-end-directed kinetochore motor which plays an important role in chromosome congression, microtubule-kinetochore conjugation and spindle assembly checkpoint activation. Drives chromosome congression (alignment of chromosomes at the spindle equator resulting in the formation of the metaphase plate) by mediating the lateral sliding of polar chromosomes along spindle microtubules towards the spindle equator and by aiding the establishment and maintenance of connections between kinetochores and spindle microtubules (PubMed:7889940, PubMed:23891108, PubMed:25395579). The transport of pole-proximal chromosomes towards the spindle equator is favored by microtubule tracks that are detyrosinated (PubMed:25908662). Acts as a processive bi-directional tracker of dynamic microtubule tips; after chromosomes have congressed, continues to play an active role at kinetochores, enhancing their links with dynamic microtubule ends (PubMed:23955301). Suppresses chromosome congression in NDC80-depleted cells and contributes positively to congression only when microtubules are stabilized (PubMed:25743205). Plays an important role in the formation of stable attachments between kinetochores and spindle microtubules (PubMed:17535814) The stabilization of kinetochore-microtubule attachment also requires CENPE-dependent localization of other proteins to the kinetochore including BUB1B, MAD1 and MAD2. Plays a role in spindle assembly checkpoint activation (SAC) via its interaction with BUB1B resulting in the activation of its kinase activity, which is important for activating SAC. Necessary for the mitotic checkpoint signal at individual kinetochores to prevent aneuploidy due to single chromosome loss (By similarity).
Microtubule-associated force-producing protein that plays a role in organelle transport. Its motor activity is directed toward the microtubule's plus end (By similarity). Cooperates with dynein in organizing spindle assembly during cell division.
Probable minus end-directed motor protein with a microtubule-enhanced ATPase activity. Binds ATP/ADP in vitro. Retains total enzymatic activity even after the removal of the ADP bound in the active site.
Involved in tethering the chromosomes to the spindle pole and in chromosome movement. Microtubule-based anterograde translocator for membranous organelles. Plus end-directed microtubule sliding activity in vitro (By similarity).
Microtubule-associated force-producing protein that plays a role in organelle transport. Its motor activity is directed toward the microtubule's plus end (By similarity).
Microtubule-based anterograde translocator for membranous organelles. Plus end-directed microtubule sliding activity in vitro. Plays a role in primary cilia formation. Plays a role in centriole cohesion and subdistal appendage organization and function. Regulates the formation of the subdistal appendage via recruitement of DCTN1 to the centriole. Also required for ciliary basal feet formation and microtubule anchoring to mother centriole.
Microtubule-based anterograde translocator for membranous organelles. Plus end-directed microtubule sliding activity in vitro. Plays a role in primary cilia formation (PubMed:21670265). Plays a role in centriole cohesion and subdistal appendage organization and function. Regulates the formation of the subdistal appendage via recruitement of DCTN1 to the centriole. Also required for ciliary basal feet formation and microtubule anchoring to mother centriole (PubMed:23386061).
Kinesin motor protein which is required for the anterograde intraflagellar transport (IFT) along the middle segment of the sensory neuron cilia together with the kinesin II motor complex (composed of klp-11, klp-20 and kap-1) and on its own, is required for IFT along the distal segment (PubMed:17000880, PubMed:17420466). In addition, regulates the length of cilia (PubMed:17420466). May have a role during neurogenesis and axonal transport (PubMed:7714894, PubMed:7690265).
Involved in synaptic transmission (PubMed:24812067). Mediates dendritic trafficking of mRNAs (By similarity). Kinesin is a microtubule-associated force-producing protein that may play a role in organelle transport. Required for anterograde axonal transportation of MAPK8IP3/JIP3 which is essential for MAPK8IP3/JIP3 function in axon elongation (By similarity).
Involved in synaptic transmission (By similarity). Kinesin is a microtubule-associated force-producing protein that may play a role in organelle transport. Mediates dendritic trafficking of mRNAs (PubMed:19608740). Required for anterograde axonal transportation of MAPK8IP3/JIP3 which is essential for MAPK8IP3/JIP3 function in axon elongation (By similarity).
Kinesin is a microtubule-associated force-producing protein that may play a role in organelle transport. Milt and Miro form an essential protein complex that links Khc to mitochondria for light chain-independent, anterograde transport of mitochondria.
May be essential to promote the progression of cytokinesis during node-internode differentiation.
Microtubule-based anterograde translocator for membranous organelles.
Microtubule-dependent motor required for slow axonal transport of neurofilament proteins (NFH, NFM and NFL) (PubMed:12682084). Can induce formation of neurite-like membrane protrusions in non-neuronal cells in a ZFYVE27-dependent manner. The ZFYVE27-KIF5A complex contributes to the vesicular transport of VAPA, VAPB, SURF4, RAB11A, RAB11B and RTN3 proteins in neurons (PubMed:21976701). Required for anterograde axonal transportation of MAPK8IP3/JIP3 which is essential for MAPK8IP3/JIP3 function in axon elongation (By similarity).
Microtubule-dependent motor required for normal distribution of mitochondria and lysosomes. May be involved in the mechanisms of growth arrest induced by exposure to DNA-damaging drugs or by cellular senescence (PubMed:9657148). Can induce formation of neurite-like membrane protrusions in non-neuronal cells in a ZFYVE27-dependent manner (PubMed:21976701). Regulates centrosome and nuclear positioning during mitotic entry. During the G2 phase of the cell cycle in a BICD2-dependent manner, antagonizes dynein function and drives the separation of nuclei and centrosomes. Required for anterograde axonal transportation of MAPK8IP3/JIP3 which is essential for MAPK8IP3/JIP3 function in axon elongation (By similarity).
Microtubule-dependent motor required for normal distribution of mitochondria and lysosomes. Can induce formation of neurite-like membrane protrusions in non-neuronal cells in a ZFYVE27-dependent manner. Regulates centrosome and nuclear positioning during mitotic entry. During the G2 phase of the cell cycle in a BICD2-dependent manner, antagonizes dynein function and drives the separation of nuclei and centrosomes (By similarity). Required for anterograde axonal transportation of MAPK8IP3/JIP3 which is essential for MAPK8IP3/JIP3 function in axon elongation (PubMed:23576431).
Microtubule-dependent motor required for slow axonal transport of neurofilament proteins (NFH, NFM and NFL). Can induce formation of neurite-like membrane protrusions in non-neuronal cells in a ZFYVE27-dependent manner. The ZFYVE27-KIF5A complex contributes to the vesicular transport of VAPA, VAPB, SURF4, RAB11A, RAB11B and RTN3 proteins in neurons. Required for anterograde axonal transportation of MAPK8IP3/JIP3 which is essential for MAPK8IP3/JIP3 function in axon elongation.
Microtubule-dependent motor required for normal distribution of mitochondria and lysosomes. Can induce formation of neurite-like membrane protrusions in non-neuronal cells in a ZFYVE27-dependent manner (By similarity). Regulates centrosome and nuclear positioning during mitotic entry. During the G2 phase of the cell cycle in a BICD2-dependent manner, antagonizes dynein function and drives the separation of nuclei and centrosomes (PubMed:20386726). Required for anterograde axonal transportation of MAPK8IP3/JIP3 which is essential for MAPK8IP3/JIP3 function in axon elongation (By similarity).
Microtubule-dependent motor protein required for organelle transport (By similarity). Plays a role in endosome transport (PubMed:22634595). Involved in the nuclear migration of hyp7 hypodermal precursor cells (PubMed:19605495, PubMed:27697906). Required for the formation of dendritic branches of PVD sensory neurons (PubMed:21205795).
Microtubule-dependent motor required for slow axonal transport of neurofilament proteins (NFH, NFM and NFL). Can induce formation of neurite-like membrane protrusions in non-neuronal cells in a ZFYVE27-dependent manner. The ZFYVE27-KIF5A complex contributes to the vesicular transport of VAPA, VAPB, SURF4, RAB11A, RAB11B and RTN3 proteins in neurons (By similarity). Required for anterograde axonal transportation of MAPK8IP3/JIP3 which is essential for MAPK8IP3/JIP3 function in axon elongation (PubMed:23576431).
Probable plus end-directed motor protein that functions in the NACK-PQR (NPK1-NQK1/MEK1-NRK1) MAP kinase signaling pathway, which is essential for somatic cell cytokinesis, especially for the cell-plate formation and its expansion. Regulates the activity and the localization of NPK1 by association through the non-catalytic region of the kinase.
Transports vesicles containing N-methyl-D-aspartate (NMDA) receptor 2B along microtubules.
Plus-end directed kinesin-like motor enzyme involved in mitotic spindle assembly.
Binds ATP/ADP in vitro. Possesses low ATPase activity but high affinity for microtubules.
Microtubule-associated force-producing protein that plays a role in organelle transport. Its motor activity is directed toward the microtubule's plus end. The maximal velocity in an inverted motility assay (moving microtubules on fixed motors) was 1.96 um/s.
Probable plus end-directed motor protein that functions in the NACK-PQR (ANP3-MKK6-MPK4) MAP kinase signaling pathway, which is essential for somatic cell cytokinesis, especially for the cell-plate formation and its expansion. May regulate the activity and the localization of ANP3, probably by association through the non-catalytic region of the kinase. Functionally redundant with NACK1 and essential to promote the progression of cytokinesis and for cellularization (formation of the cell plate) during microgametogenesis and megagametogenesis.
Probable plus end-directed motor protein that functions in the NACK-PQR (ANP1-MKK6-MPK4) MAP kinase signaling pathway, which is essential for somatic cell cytokinesis, especially for the cell-plate formation and its expansion. Regulates the activity and the localization of ANP1, probably by association through the non-catalytic region of the kinase. Functionally redundant with NACK2 and essential to promote the progression of cytokinesis and for cellularization (formation of the cell plate) during microgametogenesis and megagametogenesis.
Kinesin-like motor protein involved in the control of the oriented deposition of cellulose microfibrils (PubMed:12468730, Ref.6). Its motor activity is directed toward the microtubule's plus end. It possesses the potential to drive long-distance transport of cargo along cortical microtubules (PubMed:21914648, PubMed:25646318). Regulates cell wall mechanics during cell elongation, by the regulation of primary and secondary walls deposition (Ref.6, PubMed:25600279, PubMed:25646318). Contributes to cortical microtubule-mediated trafficking of cell wall components (PubMed:25646318).
Plus-end directed microtubule motor that may be used for anterograde axonal transport and could conceivably move cargos in fly neurons different than those moved by kinesin heavy chain or other plus-end directed motors.
Required for mitotic chromosomal positioning and bipolar spindle stabilization.
Probable plus end-directed motor protein that may function in the NACK-PQR (NPK1-NQK1/MEK1-NRK1) MAP kinase signaling pathway, which is essential for somatic cell cytokinesis, especially for the cell-plate formation and its expansion. May regulate the activity and the localization of NPK1, probably by association through the non-catalytic region of the kinase.
Motor protein that translocates PRC1 to the plus ends of interdigitating spindle microtubules during the metaphase to anaphase transition, an essential step for the formation of an organized central spindle midzone and midbody and for successful cytokinesis. May play a role in mitotic chromosomal positioning and bipolar spindle stabilization.
Motor protein that translocates PRC1 to the plus ends of interdigitating spindle microtubules during the metaphase to anaphase transition, an essential step for the formation of an organized central spindle midzone and midbody and for successful cytokinesis. May play a role in mitotic chromosomal positioning and bipolar spindle stabilization (By similarity).
Plus-end directed kinesin-like motor enzyme involved in mitotic spindle assembly. Required for centrosome separation and maintenance of spindle bipolarity during mitosis (By similarity).
Plus-end directed kinesin-like motor enzyme involved in mitotic spindle assembly. Plays a role in positioning spindle poles during mitosis, specifically at prometaphase.
Kinesin-like motor protein involved in the control of the oriented deposition of cellulose microfibrils.
Cytoplasmic motor that could play a role in Golgi membrane recycling.
Responsible for microtubule translocation. May be important for the organization of phragmoplast-specific arrays of microtubules (PubMed:7983184). Plays an essential role in stabilizing the mitotic spindle. Required during mitotic cytokinesis (By similarity).
Component of the kinesin II motor complex (composed of kap-1 and the heterodimeric motor proteins klp-11 and klp-20) which is required for intraflagellar transport (IFT) (PubMed:20833139, PubMed:20498083). Heterodimerizes with klp-11 to form a 'processive' molecular motor upon IFT cargo binding, which, within the kinesin II motor complex, binds to and moves along microtubules in a unidirectional manner (without dissociation of the heterodimer), and in turn, is responsible for the IFT of cargo (PubMed:20498083). Specifically, the kinesin II motor complex, together with the kinesin motor protein osm-3 moves along microtubules and is required for anterograde IFT along the middle segment of the sensory neuron cilia (PubMed:17000880, PubMed:20833139, PubMed:28479320). In particular, the kinesin II motor complex delivers specific ciliary cargo proteins such as che-3 which are related to motility to ciliary tips (PubMed:28479320). This is likely mediated by IFT complexes A and B (PubMed:28479320).
Plays an essential role in motile ciliogenesis.
Plus end-directed motor protein involved in asymmetric cell division of sensory organ precursor (SOP) cells by playing a role in the asymmetric localization of Sara-expressing endosomes to the pIIa daughter cell but not to the pIIb cell. Targets Sara-expressing endosomes to the central spindle which is symmetrically arranged in early cell division. During late cytokinesis, central spindle asymmetry is generated by enrichment of Patronin on the pIIb side which protects microtubules from depolymerization by Klp10A while unprotected microtubules on the pIIa side are disassembled by Klp10A, leading to the asymmetric delivery of Sara-expressing endosomes to the pIIa daughter cell (PubMed:26659188). Also plays a role in regulation of autophagosome formation, fusion and positioning and is required for normal localization of Rab14 (PubMed:26763909).
Plus-end directed kinesin-like motor enzyme involved in mitotic spindle assembly. Required for centrosome separation and maintenance of spindle bipolarity during mitosis.
Plus end-directed motor protein required for establishing a bipolar spindle (PubMed:15583027). Associates with both interphase and spindle microtubules (PubMed:15583027). May be involved in nuclear divisions taking place during the development of unfertilized eggs (PubMed:15583027). Required in non-mitotic cells for transport of secretory proteins from the Golgi complex to the cell surface (By similarity).
Responsible for microtubule translocation. May be important for the organization of phragmoplast-specific arrays of microtubules (By similarity). Plays an essential role in stabilizing the mitotic spindle (PubMed:17652157). Required during mitotic cytokinesis (PubMed:26745275).
Responsible for microtubule translocation. May be important for the organization of phragmoplast-specific arrays of microtubules (By similarity). Plays an essential role in stabilizing the mitotic spindle. Required during mitotic cytokinesis (By similarity).
Microtubule-dependent motor protein involved in the control of the oriented deposition of cellulose microfibrils (PubMed:20444225, PubMed:21325138). Involved in wall biogenesis and modification, and contributes to cell-cycle progression and cell division (PubMed:20444225). Acts as a transcriptional activator in gibberellic acid (GA) biosynthesis pathway. Binds specifically to the DNA sequence 5'-ACCAACTTGAA-3' of the ent-kaurene oxidase 2 (CYP701A6 or OsKO2) promoter. May regulate CYP701A6 gene expression and mediates cell elongation by regulating the GA biosynthesis pathway (PubMed:21325138).
Motor protein required for establishing a bipolar spindle during mitosis (PubMed:19001501). Required in non-mitotic cells for transport of secretory proteins from the Golgi complex to the cell surface (PubMed:23857769).
Plus end-directed motor protein required for establishing a bipolar spindle. Associates with both interphase and mitotic spindle microtubules. May be involved in nuclear divisions taking place during the development of unfertilized eggs. Required in non-mitotic cells for transport of secretory proteins from the Golgi complex to the cell surface.
Microtubule-depolymerizing kinesin which plays a role in chromosome congression by reducing the amplitude of preanaphase oscillations and slowing poleward movement during anaphase, thus suppressing chromosome movements. May stabilize the CENPE-BUB1B complex at the kinetochores during early mitosis and maintains CENPE levels at kinetochores during chromosome congression (By similarity).
Motor protein required for establishing a bipolar spindle during mitosis. Required in non-mitotic cells for transport of secretory proteins from the Golgi complex to the cell surface.
Microtubule-dependent motor protein involved in the control of the oriented deposition of cellulose microfibrils.

Cofactor

Mg(2+)

Subunit

Monomer. Interacts with CENPF, SEPT7 KIF18A and PRC1 (By similarity). Interacts with BUB1B (PubMed:12925705). Interacts with SKAP; this interaction greatly favors SKAP binding to microtubules. Interacts with TRAPPC12 and CTCF (By similarity).
Monomer (PubMed:15236970). Interacts with CENPF (PubMed:9763420). Interacts with BUB1B (PubMed:9763420, PubMed:19625775). Interacts with SEPT7 (PubMed:18460473). Interacts with KIF18A (PubMed:19625775). Interacts with PRC1 (PubMed:15297875). Interacts with NUF2; this interaction determines kinetochore localization (PubMed:17535814). Interacts with SKAP; this interaction greatly favors SKAP binding to microtubules (PubMed:22110139). Interacts with TRAPPC12 (PubMed:25918224). Interacts with CTCF (PubMed:25395579).
Binds microtubules (PubMed:16672264). Homodimer (PubMed:16751590).
Heterodimer of KIF3A and KIF3B. Interacts directly with IFT20 (By similarity). Interacts with the SMC3 subunit of the cohesin complex.
Interacts with the SMC3 subunit of the cohesin complex (By similarity). Heterodimer of KIF3A and KIF3B (PubMed:7559760). Interacts directly with IFT20 (PubMed:12821668).
Heterotrimer of a 115 kDa subunit (KAP115) and two kinesin-like subunits of 95 kDa (KRP95) and 85 kDa (KRP85).
Heterodimer of KIF3A and KIF3B. Interacts with PIFO. Interacts with CLN3. Interacts with DCTN1.
Heterodimer of KIF3A and KIF3B (By similarity). Interacts with PIFO (PubMed:20643351). Interacts with CLN3 (PubMed:22261744). Interacts with DCTN1 (By similarity).
Heterodimer of KIF3A and KIF3B (PubMed:7559760). Interacts with PIFO (PubMed:20643351). Interacts with CLN3 (By similarity). Interacts with DCTN1 (PubMed:23386061).
Oligomer composed of two heavy chains and two light chains.
Oligomer composed of two heavy chains and two light chains. Interacts with GRIP1 and KLC3 (By similarity). Interacts with TRAK1 (PubMed:15644324). Interacts with ZFYVE27 (By similarity).
Oligomer composed of two heavy chains and two light chains (PubMed:15286375). Interacts with GRIP1 (PubMed:11986669). Interacts with KLC3 and TRAK1 (By similarity). Interacts with ZFYVE27 (PubMed:21976701).
Interacts with D1BLIC, DHC1B and DAW1.
Heterodimer of KIF3A and KIF3C.
Oligomer composed of two heavy chains and two light chains. Interacts with GRIP1 (PubMed:11986669). Interacts with FMR1 (via C-terminus); this interaction is increased in a mGluR-dependent manner (PubMed:18539120). Interacts with BORCS5 (By similarity). Interacts with ZFYVE27 (PubMed:21976701, PubMed:24251978). Interacts with VAPA, VAPB, SURF4, RAB11A (GDP-bound form), RAB11B (GDP-bound form) and RTN3 in a ZFYVE27-dependent manner (PubMed:21976701). Interacts with BICD2 (By similarity).
Oligomer composed of two heavy chains and two light chains. Interacts with GRIP1 and PPP1R42 (PubMed:11986669, PubMed:19886865). Interacts with SYBU (By similarity). Interacts with JAKMIP1 (PubMed:17532644). Interacts with PLEKHM2. Interacts with ECPAS (By similarity). Interacts with ZFYVE27 (PubMed:21976701). Found in a complex with OGT, RHOT1, RHOT2 and TRAK1 (By similarity).
Oligomer composed of two heavy chains and two light chains. Interacts with GRIP1 and PPP1R42 (By similarity). Interacts with SYBU. Interacts with JAKMIP1. Interacts with PLEKHM2. Interacts with ECPAS (By similarity). Interacts with ZFYVE27 (By similarity). Found in a complex with OGT, RHOT1, RHOT2 and TRAK1 (PubMed:24995978).
Oligomer composed of two heavy chains and two light chains. Interacts with GRIP1. Interacts with FMR1 (via C-terminus); this interaction is increased in a mGluR-dependent manner. Interacts with ZFYVE27. Interacts with VAPA, VAPB, SURF4, RAB11A (GDP-bound form), RAB11B (GDP-bound form) and RTN3 in a ZFYVE27-dependent manner (By similarity). Interacts with BORCS5 (PubMed:25898167). Interacts with BICD2 (PubMed:20386726).
Oligomer composed of two heavy chains and two light chains. Interacts with GRIP1 and PPP1R42 (By similarity). Interacts with SYBU (PubMed:15459722). Interacts with JAKMIP1 (PubMed:17532644). Interacts with PLEKHM2 (PubMed:15905402). Interacts with ECPAS (PubMed:20682791). Interacts with ZFYVE27 (By similarity). Found in a complex with OGT, RHOT1, RHOT2 and TRAK1 (PubMed:24995978).
Oligomer composed of two heavy chains and two light chains. Interacts with GRIP1. Interacts with FMR1 (via C-terminus); this interaction is increased in a mGluR-dependent manner. Interacts with BORCS5. Interacts with ZFYVE27. Interacts with VAPA, VAPB, SURF4, RAB11A (GDP-bound form), RAB11B (GDP-bound form) and RTN3 in a ZFYVE27-dependent manner. Interacts with BICD2.
Interacts (via C-terminus) with NPK1 (via C-terminus).
Interacts with LIN-10 PDZ domain. Interacts with PIWIL1 (By similarity). Interacts with TBATA (By similarity).
Interacts with MKI67 and TPX2.
Binds microtubules.
Interacts with LIN-10 PDZ domain. Interacts with PIWIL1. Interacts with TBATA.
Dimer.
Interacts with ANP3 (PubMed:21575092). Interacts with TIO/FU (PubMed:24146312).
Homodimer.
Interacts with unphosphorylated PRC1 during late mitosis.
Homodimer. Dimerization is required for targeting to microtubule minus ends. Found in a complex with tpx2 and microtubules. Its association with microtubules and targeting to microtubule minus ends requires tpx2 (By similarity).
Component of the kinesin II motor complex, a heterotrimeric complex composed of kap-1, klp-11 and klp-20 (PubMed:17000880, PubMed:20833139, PubMed:20498083, PubMed:28479320). Interacts (via C-terminus) with klp-11 (via C-terminus) to form a heterodimer (PubMed:20498083, PubMed:21917588). Furthermore, within the heterodimer, the C-termini of klp-20 and klp-11 interact to form a coiled coil (stalk) or tail domain, and this is necessary for association with kap-1, and kinesin II motor complex activity upon IFT cargo binding (PubMed:20498083, PubMed:21917588). Prior to cargo binding, the klp-11/klp-20 heterodimer is autoinhibited by the tail domain of the heterodimer, which folds onto the kinesin motor domain (PubMed:20498083). Cargo binding to the heterodimer relieves the autoinhibition, and allows for an extended conformation of the tail domain, and function of the heterodimer (PubMed:20498083).
Interacts with STK36.
Interacts with Atg8a and Rab14.
Homodimer. Dimerization is required for targeting to microtubule minus ends. Found in a complex with tpx2 and microtubules. Its association with microtubules and targeting to microtubule minus ends requires tpx2.
Heterotetramer of two heavy and two light chains. Interacts with aurka.
Heterotetramer of two heavy and two light chains. Interacts with aurka (By similarity).
Interacts with the thyroid hormone receptor in the presence of thyroid hormone. Component of a large chromatin remodeling complex, at least composed of MYSM1, PCAF, RBM10 and KIF11/TRIP5. Interacts (via C-terminus) with the kinase NEK6 in both interphase and mitosis.
Interacts with CENPE and ESR1.
Interacts with the thyroid hormone receptor in the presence of thyroid hormone. Component of a large chromatin remodeling complex, at least composed of MYSM1, PCAF, RBM10 and KIF11/TRIP5.

Miscellaneous

Expression of a truncated protein lacking the motor domain causes inhibition of phragmoplast expansion and multinucleate cells.
Overexpression of KIN4A/FRA1 caused a severe reduction in the thickness of secondary walls in interfascicular fibers and deformation of vessels, an increase in the number of secondary wall layers, which are accompanied with a marked decrease in stem strength.

Similarity

Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family.
Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family. KIN-7 subfamily.
Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family. Kinesin II subfamily.
Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family. Kinesin subfamily.
Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family. KLP2 subfamily.
Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family. KIN-4 subfamily.
Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family. Chromokinesin subfamily.
Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family. KIN-5/BimC subfamily.
Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family. KIF27 subfamily.
Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family. BimC subfamily.
Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family. KIN-12 subfamily.

Keywords

ATP-binding   Cell cycle   Cell division   Centromere   Chromosome   Coiled coil   Complete proteome   Cytoplasm   Cytoskeleton   Developmental protein   Kinetochore   Lipoprotein   Methylation   Mitosis   Motor protein   Nucleotide-binding   Phosphoprotein   Prenylation   Reference proteome   Ubl conjugation   3D-structure   Alternative splicing   Direct protein sequencing   Disease mutation   Microtubule   Polymorphism   Primary microcephaly   Transport   Chloroplast   Plastid   Transit peptide   Metal-binding   Zinc   Zinc-finger   Alternative initiation   Mitochondrion   Acetylation   Cell projection   Cilium   Isopeptide bond   Amyotrophic lateral sclerosis   Epilepsy   Hereditary spastic paraplegia   Neurodegeneration   Nucleus   Protein transport   DNA-binding   Mental retardation   Autophagy   Endosome   Activator   Growth regulation   Transcription   Transcription regulation   Glycoprotein  

Feature

chain  Centromere-associated protein E
propeptide  Removed in mature form
splice variant  In isoform 3.
sequence variant  In MCPH13; results in defective mitotic spindle formation and chromosome segregation; results in delayed mitotic progression; dbSNP:rs144716013.

Uniprot

Q6RT24.1   Q02224.2   Q2R2P7.1   B9G3M6.2   F4J2K4.1   Q54NP8.1   + More
Q9S7P3.1   F4K3X8.2   Q9FW70.2   B9FFA3.2   F4J8L3.1   Q6YZ52.2   Q8W5R5.1   Q8W5R6.1   Q9SJU0.2   B9FS33.2   O15066.1   Q61771.1   P46871.1   Q6S001.1   Q4R628.1   Q5R4H3.1   Q9Y496.4   P28741.2   P21613.1   Q86ZC1.1   P46872.1   O43093.1   P46873.4   O60282.1   P28738.3   P48467.2   P46869.1   P17210.2   Q9AWM8.1   P35978.1   O35066.3   Q651Z7.1   O14782.3   F4IGL2.1   P33175.3   Q61768.3   Q2PQA9.1   Q6H638.1   Q12840.2   Q5R706.1   P33176.1   O55165.1   P34540.2   Q6QLM7.1   Q8S950.1   Q5R9K7.1   Q6Z9D2.2   Q9P2E2.3   A0JN40.1   F4JUI9.1   Q9NS87.1   Q7X7H4.2   Q99PW8.1   Q86Z98.1   Q54UC9.1   Q6P9L6.1   Q8LNZ2.1   Q7TSP2.1   Q8S905.1   Q8GS71.1   P46867.2   P33174.3   Q8S949.1   O95239.3   Q2VIQ3.2   Q498L9.1   Q9GYZ0.1   Q91784.1   Q29DY1.1   F4K0J3.2   Q9US60.1   O23826.1   Q965T6.1   Q86VH2.1   Q7M6Z4.1   Q9VB25.2   Q91785.1   P28025.2   Q7M6Z5.1   F4IIS5.1   P82266.2   B7EJ91.2   Q91783.1   Q90640.1   Q75LL2.1   F4JZ68.1   Q6YUL8.1   P52732.2   B2GU58.1   A0A068FIK2.1   Q91WD7.1   F4J1U4.1   Q6P9P6.1   B9F2Y7.1  

Pubmed

12925705    15489334    16141072    9275178    12361599    21183079    + More
1406971    15815621    14702039    7889940    9763420    10852915    15297875    17535814    18460473    18374647    18669648    19625775    21269460    22110139    23891108    23186163    23955301    24748105    26321640    25918224    25395579    25743205    25908662    15236970    16188032    16100779    18089549    24280374    15685292    12869764    19106179    11130713    27862469    11472632    16448571    22038119    9693369    15875012    14641909    18430243    10548732    11130712    12791992    12447439    10907853    11910074    16672264    16751590    20849820    11706156    10617198    14593172    19376835    10617197    9205841    11780052    9506951    22814378    7559760    12821668    25243405    8232586    10548469    15372022    20643351    20068231    22261744    23386061    1447303    19468303    15345747    21670265    2137456    12742059    9613604    7714894    9851916    7690265    17000880    17420466    27623382    28479320    9628581    9361024    15644324    24812067    23033978    23603762    29048727    12106288    9782088    11986669    19608740    21976701    15286375    8589459    12712197    11707393    8027176    17895364    18852297    2522352    10731132    12537572    12537569    1384131    16717129    12447438    16183700    1827446    9450952    16452087    9480755    9446808    26138355    12682084    18539120    24251978    9112396    8170981    9657148    17532644    17242355    19886865    24129315    10573845    7514426    22673903    23576431    24995978    19413330    20386726    25898167    12355402    15452312    16476820    16489470    18203753    18245137    18853458    21107874    24215330    27463701    27414745    29342275    29566793    1607388    15164054    15459722    15905402    17081983    20682791    22223895    24275569    28112733    8606779    12368902    17470637    9487132    9808286    8105472    7906398    19605495    21205795    22634595    27697906    9405049    11955449    12472693    22006334    14673085    16710414    10718198    10878014    17974005    12747765    12612055    19608861    21278385    10846156    16787948    17196196    12952062    10545495    18160177    14618103    12694597    9217006    9224679    15569152    19825582    20802223    21575092    24146312    11818068    23451828    25502072    26745275    12468730    10048488    21914648    25600279    25646318    7525600    1924306    7929562    10978527    15772651    9168136    11736643    15625105    16964243    18318008    16201836    8548825    10931863    7720067    8482413    15632085    9501997    10641037    12132578    11859360    9044048    7983184    16530461    20833139    20498083    21917588    12783626    15164053    19305393    26659188    26763909    9813089    10871281    1710028    10329703    15583027    19001501    19079595    15057822    12361973    17652157    14993207    8026619    7876303    8108415    16109971    10718197    20444225    21325138    8548803    9701554    7776974    17525332    21406692    23857769    11328809    17707232    22284827    10659681   

EMBL

AY493378    BC049989    BC052843    BC059032    BC106096    AK049676    + More
AK133445    AB001426    AAH49989.1    AAH52843.1    AAH59032.1    AAI06097.1    AAR85498.1    BAA22386.1    BAC33868.1    BAE21661.1    Z15005    AB209996    AC079919    CH471057    AK290362    DP000010    AP008217    AP014967    CM000148    AK106372    ABA94250.1    BAT14435.1    EAZ18722.1    AP005579    AP008215    AP014965    CM000146    AK059290    BAD33631.1    BAT08128.1    EEE69723.1    AC009400    CP002686    AAF02823.1    AAF02824.1    AB102780    AF015713    AAFI02000074    AB028468    AB028470    AC009317    AC027036    CP002684    AAF79747.1    AAK62792.1    BAA88114.1    AP002543    AP002032    CP002688    BAB11416.1    AC068924    DP000086    AP014966    CM000147    AK242756    AAG13527.1    AAP54589.2    BAT11636.1    EAZ16667.1    AL606626    AL606706    AP014960    CM000141    BAS89294.1    CAD41022.1    CAE03214.2    EEE61037.1    AP002040    AC069473    AK117552    AAG51044.1    BAB03114.1    AP004853    AP005538    AP014958    CM000139    AK068672    BAD17149.1    BAD17367.1    BAS81163.1    EEE57896.1    AB062739    AL035679    AL161594    CP002687    AY091060    AY150516    BAB71852.1    CAB38825.1    AB062738    AC007727    AAD41428.1    BAB71851.1    AC006841    CP002685    AY039966    AY150452    AAD23684.2    AP014962    CM000143    BAS96703.1    EEE65294.1    AB002357    AK299877    AL121897    AL354800    CH471077    BC136310    BC136311    D26077    U00996    AY484464    AAFI02000174    AB169362    CR861275    AF041853    AB209780    AC004039    AC004237    BC045542    D12645    AL596095    BC052707    J05258    AY230415    L16993    AJ225894    D38632    FO081251    D14968    AB011103    AC105402    AC108512    AC144443    AC144611    BC110287    AF010146    X61435    AF067180    AL845332    AL929069    CH466519    BC067051    L47106    CM002239    L33697    M24441    AE013599    AY094959    AP002970    AP008207    AP014957    CM000138    AK103077    BAB32972.1    BAF05100.1    EEE54684.1    X56844    AF013116    AK147572    CH466623    BC127063    AB001433    AP005681    AK072633    BAD46370.1    BAT09068.1    EEE70089.1    AF018164    AF035621    AJ002223    AJ002224    AJ002225    AJ002226    AJ002227    AJ002228    AJ002229    AC013449    AC064847    BC092406    BC130423    AK221265    AAD23678.1    AF067179    AK147352    AK147660    AK147707    AK220479    BC058396    U86090    BC090841    L27153    L29223    DQ309275    AF155822    AAD39239.1    ABC25059.1    AP005306    AP008208    AK100979    AK242767    BAD25811.1    BAF09485.1    EEE57470.1    U06698    AB210045    CH471054    BC146670    BC150208    CR860317    X65873    AL161932    BC126279    BC126281    AJ223599    AF083330    AB017163    L19120    FO081667    AY535015    AAS45402.1    AB071435    CR859380    AP004704    AP008214    AP014964    CM000145    AK065731    AK102208    BAD09937.1    BAD09938.1    BAT06556.1    EEE69110.1    AY484427    AL391357    AL663074    BC036871    BC065927    AB037826    AF009624    BC126505    AK230191    CAB38815.1    AB035898    AK027816    BC117174    AL832908    AF308294    AL606459    AL606587    AP008210    AK102262    BAF15347.1    BAS90272.1    CAE02777.2    CAE03025.3    EEE61418.1    AB008867    AL807249    AY230438    AY484460    AAFI02000040    AY162212    AF015714    AJ560623    BC060710    AB001432    AB088121    AJ495781    AJ496182    AJ508243    AJ507734    AL353871    BAC03248.1    CAB89042.1    CAD42234.1    CAD42658.1    CAD45645.1    CAD48111.1    AY291580    AY291581    AB081599    AC013354    AAF25984.1    BAB88748.1    AY158083    AY158084    AB016886    AAN86114.1    BAB11329.1    U15974    AE014296    AY051583    M74431    D12646    BX005480    BX276129    CH466564    BC050946    AB071436    AF179308    AF071592    AJ271784    AK313133    AL139398    AL357752    CH471132    BC049218    BC050548    AF277375    AF241316    DQ120629    BC071083    BC100163    AF284333    X82012    CH379070    EAL30282.1    AB008269    AK118373    BAB10642.1    AF154055    AF156966    AF247188    CU329670    D83711    BX284603    AY237536    AY237537    AY237538    AL354733    BC140788    AL133654    BC116646    AK032912    BK001056    AE014297    AY070884    BT132947    M74432    AAA28659.1    AAL48506.1    AEW43887.1    X94082    X54002    AABR03104681    AABR03107397    AABR03106101    AABR03107556    BK001053    AC007171    AAD24373.1    AC006921    BX819626    AAD21445.1    AK071334    BAT06676.1    BAT06677.1    X71864    U18309    U04821    AC092556    DP000009    AP008209    AP014959    CM000140    AAR87264.1    ABF98896.1    BAH92370.1    BAS86403.1    EAZ28596.1    AB022211    AF372930    BAB10710.1    AP005860    AK100974    BAD16507.1    BAD16508.1    BAF24494.1    EEE69196.1    X85137    U37426    AL360222    AL356128    BC126211    BC136474    L40372    EF524557    EF524558    BC166147    AAI66147.1    ABX55790.1    AK044795    AK164649    BC016095    AL163975    AL353814    CAB88133.1    BC060670    AJ223293    AP004800    AP005297    AK064545    AK106279    BAD15740.1    BAD16101.1    BAF10005.1    BAF10006.1    EEE57794.1   

Proteomes

UP000000589    UP000005640    UP000059680    UP000006548    UP000002195    UP000007110    + More
UP000233100    UP000001595    UP000001940    UP000001805    UP000000803    UP000002494    UP000084051    UP000009136    UP000001819    UP000002485    UP000000539    UP000008143   

PRIDE

Q6RT24    Q02224    B9G3M6    Q54NP8    F4K3X8    F4J8L3    + More
Q8W5R5    Q8W5R6    Q9SJU0    B9FS33    O15066    Q61771    P46871    Q4R628    Q9Y496    P28741    P21613    Q86ZC1    P46872    O43093    P46873    O60282    P28738    P48467    P46869    P17210    P35978    O35066    O14782    F4IGL2    P33175    Q61768    Q2PQA9    Q12840    Q5R706    P33176    O55165    P34540    Q6QLM7    Q8S950    Q5R9K7    Q9P2E2    A0JN40    F4JUI9    Q9NS87    Q99PW8    Q86Z98    Q54UC9    Q6P9L6    Q8LNZ2    Q7TSP2    Q8S905    Q8GS71    P46867    P33174    Q8S949    O95239    Q2VIQ3    Q498L9    Q91784    Q29DY1    F4K0J3    Q9US60    Q86VH2    Q7M6Z4    Q9VB25    P28025    Q7M6Z5    F4IIS5    P82266    Q90640    P52732    B2GU58    Q91WD7    F4J1U4    Q6P9P6   

Pfam

PF00225   Kinesin        + More
PF11995   DUF3490
PF15908   HMMR_C
PF00787   PX
PF13931   Microtub_bind

Interpro

IPR019821   Kinesin_motor_CS        + More
IPR027417   P-loop_NTPase       
IPR036961   Kinesin_motor_dom_sf       
IPR001752   Kinesin_motor_dom       
IPR027640   Kinesin-like_fam       
IPR001841   Znf_RING       
IPR013083   Znf_RING/FYVE/PHD       
IPR021881   NACK_C       
IPR031794   HMMR_C       
IPR033467   Tesmin/TSO1-like_CXC       
IPR008984   SMAD_FHA_dom_sf       
IPR036871   PX_dom_sf       
IPR001683   Phox       
IPR000253   FHA_dom       
IPR025901   Kinesin-assoc_MT-bd_dom       

SUPFAM

SSF52540   SSF52540        + More
SSF49879   SSF49879       
SSF64268   SSF64268       

Gene 3D

3.40.850.10     3.30.40.10     3.30.1520.10    

CDD

cd00060  FHA

ProteinModelPortal

Q6RT24.1   Q02224.2   Q2R2P7.1   B9G3M6.2   F4J2K4.1   Q54NP8.1   + More
Q9S7P3.1   F4K3X8.2   Q9FW70.2   B9FFA3.2   F4J8L3.1   Q6YZ52.2   Q8W5R5.1   Q8W5R6.1   Q9SJU0.2   B9FS33.2   O15066.1   Q61771.1   P46871.1   Q6S001.1   Q4R628.1   Q5R4H3.1   Q9Y496.4   P28741.2   P21613.1   Q86ZC1.1   P46872.1   O43093.1   P46873.4   O60282.1   P28738.3   P48467.2   P46869.1   P17210.2   Q9AWM8.1   P35978.1   O35066.3   Q651Z7.1   O14782.3   F4IGL2.1   P33175.3   Q61768.3   Q2PQA9.1   Q6H638.1   Q12840.2   Q5R706.1   P33176.1   O55165.1   P34540.2   Q6QLM7.1   Q8S950.1   Q5R9K7.1   Q6Z9D2.2   Q9P2E2.3   A0JN40.1   F4JUI9.1   Q9NS87.1   Q7X7H4.2   Q99PW8.1   Q86Z98.1   Q54UC9.1   Q6P9L6.1   Q8LNZ2.1   Q7TSP2.1   Q8S905.1   Q8GS71.1   P46867.2   P33174.3   Q8S949.1   O95239.3   Q2VIQ3.2   Q498L9.1   Q9GYZ0.1   Q91784.1   Q29DY1.1   F4K0J3.2   Q9US60.1   O23826.1   Q965T6.1   Q86VH2.1   Q7M6Z4.1   Q9VB25.2   Q91785.1   P28025.2   Q7M6Z5.1   F4IIS5.1   P82266.2   B7EJ91.2   Q91783.1   Q90640.1   Q75LL2.1   F4JZ68.1   Q6YUL8.1   P52732.2   B2GU58.1   A0A068FIK2.1   Q91WD7.1   F4J1U4.1   Q6P9P6.1   B9F2Y7.1  

PDB

1T5C     E-value=4.75883e-85,     Score=810

KEGG

101743227    K11498 centromeric protein E | (RefSeq) kinesin-related protein 4

GO

GO:0045184   GO:0099606   GO:0051984   GO:0050793   GO:0015630   GO:0000778   GO:0008608   GO:0007079   GO:0000776   GO:0005874   GO:1990023   GO:0051382   GO:0000779   GO:0007080   GO:0003777   GO:0045842   GO:0045860   GO:0005524   GO:0051310   GO:0051301   GO:0000940   GO:0005828   GO:0000278   GO:0008017   GO:0007052   GO:0007018   GO:0016887   GO:0000775   GO:0043515   GO:0051315   GO:0007094   GO:0005654   GO:0005694   GO:0007275   GO:0019901   GO:0005871   GO:0030496   GO:0051233   GO:0005829   GO:0007059   GO:0007088   GO:0051987   GO:0005634   GO:0030071   GO:0099607   GO:0006890   GO:0019886   GO:0016020   GO:0000777   GO:0090307   GO:0005737   GO:0009507   GO:0046872   GO:0043531   GO:0042803   GO:0000287   GO:0005739   GO:0031347   GO:0005886   GO:0017048   GO:0032467   GO:0008089   GO:0007368   GO:0016939   GO:0008574   GO:0070062   GO:0005873   GO:0005813   GO:1904115   GO:0120170   GO:0005819   GO:0007100   GO:0072383   GO:0035735   GO:0005929   GO:0097542   GO:0030424   GO:0035371   GO:0034454   GO:0005814   GO:0010457   GO:0060271   GO:1902414   GO:0007411   GO:0017137   GO:0019903   GO:0006996   GO:0015031   GO:0030507   GO:0061351   GO:0044877   GO:0050679   GO:0021542   GO:0008544   GO:0044458   GO:0090316   GO:0007224   GO:0031514   GO:0043005   GO:0021904   GO:0005930   GO:1905515   GO:0001701   GO:0019894   GO:0001822   GO:0097470   GO:0009952   GO:0009953   GO:0021915   GO:0036334   GO:0048260   GO:0060122   GO:0007507   GO:0001947   GO:0032391   GO:1905128   GO:0043025   GO:2000771   GO:0048471   GO:0061066   GO:0046626   GO:0030030   GO:0035720   GO:0032839   GO:1902857   GO:0098971   GO:0036064   GO:1902856   GO:0043053   GO:0097730   GO:0042073   GO:0035253   GO:0008045   GO:0099641   GO:0150034   GO:0051028   GO:0044295   GO:0048489   GO:0045202   GO:0098964   GO:0030425   GO:0098963   GO:0046034   GO:0034190   GO:0099609   GO:0097014   GO:0051012   GO:0007409   GO:0005523   GO:0001754   GO:0048311   GO:0007317   GO:0046843   GO:0035617   GO:0008088   GO:0007315   GO:0008345   GO:0061572   GO:0030478   GO:0010970   GO:0098957   GO:0046785   GO:0045451   GO:0048312   GO:0008103   GO:0051299   GO:0007303   GO:0007310   GO:0048813   GO:0007097   GO:0070868   GO:0048741   GO:0098937   GO:0003774   GO:0009524   GO:0009555   GO:0009558   GO:0000911   GO:0008021   GO:0071598   GO:0030426   GO:0010976   GO:0072384   GO:0016192   GO:0090724   GO:0000932   GO:0097440   GO:0097110   GO:0043204   GO:1990049   GO:0043268   GO:0035774   GO:0042391   GO:0071346   GO:0008432   GO:1905152   GO:0032230   GO:0047496   GO:0007028   GO:0030139   GO:0031340   GO:0006839   GO:0021766   GO:0005815   GO:0045335   GO:0043227   GO:0042802   GO:0051642   GO:0007017   GO:0031982   GO:1903078   GO:0007420   GO:0007268   GO:0045296   GO:1990048   GO:0016938   GO:0051295   GO:0051296   GO:0040038   GO:0005635   GO:0040011   GO:0030473   GO:0033206   GO:0010940   GO:0030951   GO:0048814   GO:0009792   GO:0021987   GO:0048666   GO:1990090   GO:0021794   GO:0071361   GO:1904647   GO:0000919   GO:0030992   GO:1990075   GO:0009506   GO:0031503   GO:0007112   GO:0048229   GO:0010245   GO:0030705   GO:0009832   GO:0055028   GO:0010215   GO:0005875   GO:0007608   GO:0051256   GO:0000281   GO:0003677   GO:0045171   GO:0016363   GO:0005876   GO:0000922   GO:0071555   GO:0006887   GO:0005938   GO:0005881   GO:0071963   GO:0000301   GO:0006886   GO:0030993   GO:0021591   GO:0003351   GO:0006914   GO:0140024   GO:0045022   GO:0032266   GO:0045167   GO:1901981   GO:0005769   GO:0007049   GO:0009826   GO:0043622   GO:0040008   GO:0009937   GO:0042127   GO:0043565   GO:0005856   GO:0045893   GO:0072686   GO:0046602   GO:0007051   GO:0032991   GO:0007019   GO:0001726   GO:0003779   GO:0051010   GO:0070507   GO:0072520   GO:0007140   GO:0070463   GO:0005901   GO:0000070   GO:0061673   GO:0051225   GO:0004402   GO:0016573   GO:0008270   GO:0022891   GO:0003707   GO:0051537  

PANTHER

PTHR24115  

Subcellular location

Cytoplasm   Associates with kinetochores during congression (as early as prometaphase), relocates to the spindle midzone at anaphase, and is quantitatively discarded at the end of the cell division (PubMed:12361599, PubMed:12925705). Recruited to the kinetochore in a SEPT7, CENPQ and TRAPPC12-dependent manner. Recruited to the pericentromeric/centromeric regions of the chromosome in a CTCF-dependent manner (By similarity).   With evidence from 2 publications.
Cytoskeleton   Associates with kinetochores during congression (as early as prometaphase), relocates to the spindle midzone at anaphase, and is quantitatively discarded at the end of the cell division (PubMed:12361599, PubMed:12925705). Recruited to the kinetochore in a SEPT7, CENPQ and TRAPPC12-dependent manner. Recruited to the pericentromeric/centromeric regions of the chromosome in a CTCF-dependent manner (By similarity).   With evidence from 2 publications.
Spindle   Associates with kinetochores during congression (as early as prometaphase), relocates to the spindle midzone at anaphase, and is quantitatively discarded at the end of the cell division (PubMed:12361599, PubMed:12925705). Recruited to the kinetochore in a SEPT7, CENPQ and TRAPPC12-dependent manner. Recruited to the pericentromeric/centromeric regions of the chromosome in a CTCF-dependent manner (By similarity).   With evidence from 2 publications.
Chromosome   Associates with kinetochores during congression (as early as prometaphase), relocates to the spindle midzone at anaphase, and is quantitatively discarded at the end of the cell division (PubMed:12361599, PubMed:12925705). Recruited to the kinetochore in a SEPT7, CENPQ and TRAPPC12-dependent manner. Recruited to the pericentromeric/centromeric regions of the chromosome in a CTCF-dependent manner (By similarity).   With evidence from 2 publications.
Centromere   Associates with kinetochores during congression (as early as prometaphase), relocates to the spindle midzone at anaphase, and is quantitatively discarded at the end of the cell division (PubMed:12361599, PubMed:12925705). Recruited to the kinetochore in a SEPT7, CENPQ and TRAPPC12-dependent manner. Recruited to the pericentromeric/centromeric regions of the chromosome in a CTCF-dependent manner (By similarity).   With evidence from 2 publications.
Kinetochore   Associates with kinetochores during congression (as early as prometaphase), relocates to the spindle midzone at anaphase, and is quantitatively discarded at the end of the cell division (PubMed:12361599, PubMed:12925705). Recruited to the kinetochore in a SEPT7, CENPQ and TRAPPC12-dependent manner. Recruited to the pericentromeric/centromeric regions of the chromosome in a CTCF-dependent manner (By similarity).   With evidence from 2 publications.
  
Mitochondrion  
Cell projection  
Cilium  
Microtubule organizing center   Localizes to the subdistal appendage region of the centriole.   With evidence from 1 publications.
Centrosome   Localizes to the subdistal appendage region of the centriole.   With evidence from 1 publications.
Centriole   Localizes to the subdistal appendage region of the centriole.   With evidence from 1 publications.
Cilium axoneme   Localizes along the full cilium length.   With evidence from 4 publications.
Cilium basal body   Localizes along the full cilium length.   With evidence from 4 publications.
Dendrite   Abundant in distal regions of dendrites.   With evidence from 7 publications.
Perinuclear region  
Nucleus  
Phragmoplast  
Nucleus matrix  
Midbody  
Spindle pole   Localizes during metaphase on spindle microtubules, with a strong enrichment at spindle poles. Localizes to the minus ends of spindle pole and aster microtubules in a dynein- and dynactin-dependent manner. Detected diffusively in the cytoplasm. Localized at the centrosome during the interphase and throughout mitosis (By similarity).   With evidence from 1 publications.
Early endosome  
Ruffle  

Length:

3052

Number of predicted TMHs:

0

Exp number of AAs in TMHs:

0.21867

Exp number, first 60 AAs:

0

Total prob of N-in:

0.01037

outside

1  -  3052

 

 

Pi

213.438414

Theta

195.303648

Tajima's D

0.326669

CLR

0.656357

CSRT

0.468876556172191

Interpretation

Uncertain