SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07672
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 2.661
 

Sequence

CDS
ATGCCGATTGGGAAAGTTGAAAGTTTTGATATGGGATCTCAAAATTGGGACACATACATTCGTCGTGTAAAACAATTCATGGAACTCAACGACATTGAACAGAGACTTCACGTTGCAACGCTCGTGACCTTAGTTGGGTCTGAGTGCTATGACTTAATGTGTGACTTGTGTGCTCCGGACTTACCAGAAGAAAAGGATTTCGACATACTCGTAAAATTAGTCAAAGATCATCTAGAACCTGAAAGATCGGAAATAGCAGAACGTCATATCTTCAGGCAAAGAAAGCAGCAAAATAACGAAAGCATTCGTTCCTACCTACAAAGTTTGAAACATTTGGCTAAAACTTGCAATTTCGGCATCACATTAGAAATTAATCTACGCGATCAATTCGTATCAGGATTATATAGCGAGGAGATGCGATCAAGGCTGTTTGCCGAAAAAGATATAGATTACAAGCGCGCTGTTGAGTTGGCATCAGCACTGGAAGCAGCGGATCGACATGCGATGGCGGCTGGGGGCACTGGGGGCAGCTCACAGGCTGCGTCCGAGAGCGAAGGCATGCATCGGGTCGGCGGAGCGCGCGCGGAGGCTCGCTGCGCCTGCAGACGCTGCGGCAAGCTGGGCCATGCGGAGGGTCGGTGTCGGTACAAGCACTACACCTGTGACTCATGTGGCGAGAAGGGACACCTAAAATCAATGTGTCGGAACCGTAAAGGTAACCAAAAGATTGAAAAAAACCGAGAAGTGTTTGCTGGAGGTTTAGGAACATGTAAATCACGCATAAAATTACATCTAAAAGAAAAGACGCCAATATTTGTAAAGGCGCGGGCGCTGCCACTGGCGTTGCGCGAGCGCGTTGAGCGAGAACTTGATCGTTTACAAAGTGAGGGAGTTATTTACAAAGTAGATAGGTCTGATTACGGCACGCCTATCGTACCAGTCGTTAAGGCAAATGGCGATATTCGTATTTGCGGCGACTATAAAATCACAATAAACCCACGTCTGAAGGATTATCACTATCCTTTGCCGCACATTAAAGATTTGTTTGCCACTTTAGGTGGTGGTGAATATTACACAAAATTGGATTTATCTAATGCATTCCAGCAATGCCTCTTAGACGAAGAATCCCAGCCGATGACAGCGATCACGACACACATTGGTACTTTTGTCTATAAGCGCGTTCCGTTTGGAATTAAATGCATTCCGGAAAACTTTCAGAAGATTATGGAAGAGATTCTAAGTGGTCTGCCTTCAACCGTTATTTTTGCGGACGATATATGTGTAACCGGAAAAAACAGATTTGAACATTTATCAAATCTACGAGCAGTCTCTCCGGTACTGGCACATTATAACCCAAATTCGCCATTAGTGCTTTCCGTTGACAGCAGCCAGTACGGACTGGGCGCCGTCCTCACTCAGAAGCACATCGACGGCACTGAGCGGCTCGTCAGCTGTGCCTCACGGACTCTCGCGCCAGCCGAACTTAACTATTCTCAGCTGGACAAAGAAGCTTTGGCTATAATGTTTGGGGTTACTAAACACCATCAGTATTTGTACGGGAGACGTTTTGTTTTACGAAGTGATCATAAGGCTTTGAGTTATATTCTTGGAAAGAATAAAGGTATACCTCTAACCGCCGCGAGTCGTCTGCAACGATTTGCTGTAAAGCTAGCTGCGTATGATTTTGAGATCGAATTTATTAGTTCTACAGATAATTGCCAGGCTGACGCGCTATCACGACTTCCACTGGATACTAATTTTAAGAATAATATTAAGGAGTATAATTACCTAAACTTCGTTCAAGAAAGCTTTCCACTCAGTTTTAAAGAAATTAAAAAGGAAGTTACGAAGGATCCTTTACTAAACAAAATTTACGGTTACGTCATGTTCGGCTGGCCCTCTGCCAGTAAAGAACAAGCAGAAAAACCCTATTTTAACAGAAGAGAATCCATACATATTGATCACGGTTGTCTTGTATGGGGTTACAGAATAATAATTCCAACTTCATTGCGAGAGACTGTGTTACAGGAGTTACATGAGGGACATCCGGGTATTGTTAAGATGAAACAATTAAGCCGGAACTACGTATGGTGGGAGACAGTCGATGCGGACATTGAACGTGTATGTGCTCAGTGCCAGGCCTGTCGGTCTCAGCGCGCTGCACCACCATCGGTGCCGCTGCACTCGTGGCCATGGCCGGAAGAGCCGTGGGCGCGCCTTAATCTTGATTTCTTGGGACCGTTTAATAACAAATATTACTTAATTATAGTGGACGCTCATTCAAAATGGATCGAGGTGGAAAAATTGAGCTGTACATCAGCCACGGCAGTAATCGCATGTCTCAGACGATTGTTTGCTCGATTTGGCTTAGCAAAAAAGGTAGTTACTGATAACGGACCACCTTTCTCGTCGGTCGAATTTAGATCATATTTAAGTAAAAACGGTATAAAACATTTACCGGTGGCTCCGTATCATCCATCTAGCAATGGGGCAGCGGAAAACGCCGTAAAAACCATAAAAAGAGTGTTGAAAAAGGCTTTAATTGAAAAGGAAGACGACAATACCGCCTTGACAAAATTTCTCTTTATGAACAGAAATTCTGAGCGTAGCACTACAGGGCGCGAACCAGCAGTTGCTTTGTTCGGACGTCGCCTGCGTGGAAGACTGGATCTGTTGCGTCCCAATACTAGCTCCATAGTACGAGAAGCACAGCTGGCAAGCGAAAGCTATAATGCAGGCACAGCCGGATATAGGGAGGCTGCAGAAGGAGACTCGGTCCTATTGCAAGATTTCACACAGGGAAAAAAGAAATGGACCCCAGGAACAATAAAAAACCGCTTAGGTCCGGTGACATACAGGGTAACAGCAGATGACGGGCGGGTACACAAACGTCACATCGACCAGATTTTAATAAGTAATAATAGTCGAAAATCACGTTATTCTTTGTCCAAATTAAACAATGATTTCGAGACAAAATCAGTAAATGATAGTGTGGGTGAAGCTCGGGAAAGTCCGGGTATGACCGGAGAAAAGGAGCTCAACTCCAGCTATGACACGGGACCGGAAAGTCCACAACCTGTGACTCCTAGTCACTCGCCAGCGCCGAATGTCTTGCAACCATGGCGTCAGCGCCGTAAAGCTGCTTTAACGTGTATTCAGAGAATTAAGGACCAAAATTACTAA
Protein
MPIGKVESFDMGSQNWDTYIRRVKQFMELNDIEQRLHVATLVTLVGSECYDLMCDLCAPDLPEEKDFDILVKLVKDHLEPERSEIAERHIFRQRKQQNNESIRSYLQSLKHLAKTCNFGITLEINLRDQFVSGLYSEEMRSRLFAEKDIDYKRAVELASALEAADRHAMAAGGTGGSSQAASESEGMHRVGGARAEARCACRRCGKLGHAEGRCRYKHYTCDSCGEKGHLKSMCRNRKGNQKIEKNREVFAGGLGTCKSRIKLHLKEKTPIFVKARALPLALRERVERELDRLQSEGVIYKVDRSDYGTPIVPVVKANGDIRICGDYKITINPRLKDYHYPLPHIKDLFATLGGGEYYTKLDLSNAFQQCLLDEESQPMTAITTHIGTFVYKRVPFGIKCIPENFQKIMEEILSGLPSTVIFADDICVTGKNRFEHLSNLRAVSPVLAHYNPNSPLVLSVDSSQYGLGAVLTQKHIDGTERLVSCASRTLAPAELNYSQLDKEALAIMFGVTKHHQYLYGRRFVLRSDHKALSYILGKNKGIPLTAASRLQRFAVKLAAYDFEIEFISSTDNCQADALSRLPLDTNFKNNIKEYNYLNFVQESFPLSFKEIKKEVTKDPLLNKIYGYVMFGWPSASKEQAEKPYFNRRESIHIDHGCLVWGYRIIIPTSLRETVLQELHEGHPGIVKMKQLSRNYVWWETVDADIERVCAQCQACRSQRAAPPSVPLHSWPWPEEPWARLNLDFLGPFNNKYYLIIVDAHSKWIEVEKLSCTSATAVIACLRRLFARFGLAKKVVTDNGPPFSSVEFRSYLSKNGIKHLPVAPYHPSSNGAAENAVKTIKRVLKKALIEKEDDNTALTKFLFMNRNSERSTTGREPAVALFGRRLRGRLDLLRPNTSSIVREAQLASESYNAGTAGYREAAEGDSVLLQDFTQGKKKWTPGTIKNRLGPVTYRVTADDGRVHKRHIDQILISNNSRKSRYSLSKLNNDFETKSVNDSVGEARESPGMTGEKELNSSYDTGPESPQPVTPSHSPAPNVLQPWRQRRKAALTCIQRIKDQNY

Summary

Pfam
PF17921   Integrase_H2C2        + More
PF00665   rve
PF17917   RT_RNaseH
PF00078   RVT_1
PF17919   RT_RNaseH_2
Interpro
IPR041373   RT_RNaseH        + More
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR000477   RT_dom       
IPR001878   Znf_CCHC       
IPR001995   Peptidase_A2_cat       
IPR021109   Peptidase_aspartic_dom_sf       
IPR041577   RT_RNaseH_2       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=1.29578e-13,     Score=190

Ontologies

Topology

Length:
1060
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00059
Exp number, first 60 AAs:
0.00018
Total prob of N-in:
0.00001
outside
1  -  1060
 
 

Population Genetic Test Statistics

Pi
241.674321
Theta
173.398229
Tajima's D
2.122863
CLR
0.0336
CSRT
0.903954802259887
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号