SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07671
Annotation
PREDICTED:_uncharacterized_protein_LOC105841331_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 0.959
 

Sequence

CDS
ATGTATCATTTTAATCGCGTTTGTTTTGGTCTACGGTGCTCGCCGTACCTTGCTATGAAGACAGTCAAGCGTCTCGCCCGCGATGAAACTGATTTCCCGATCGCTTCAGAAATCGCTAGTGATCATCTTTATATGGATGATCTAGGAGTTTCGGTAGATACGCCCGAGAATGGAATTCAGTTGGCTCATGATTTAATCGAACTATTCAAACGTGGTGGTTTCTACTTAGTTAAATTCGTTAGCAATTCGCCCGAGGTGTTAAAATCAATTCCGCAAGCCAACCGCTTATCTTCAAAAATTGAATTCGACAAGGAGGATAATATGAAGCTCCTAGGTCTAATCTGGTCACCGGTCGAGGATGAATTTTCAATCGCTATTAAATTCAACCCGCAAGCAAAATGTACAAAGCGCCTTATGCTTTCCACAATCGCTAAACTGTGGGACATAAACGGATTTTGTGCCCCTGTCATCTTACACGCAAAATTATTAATTAAAGCTCTTTGGATAGCTCAGATTGATTGGGATGTAGAGCCTCCAAGTGACATCTGTGCTGCATGGAAGCGCTTTCTTAATGAACTCCCCGCTCTGCAAGACTTTAAAATACCTCGCTTCGTAGGCATCGTGCCCGAGTCCCGTGTTATACTACTGGGATTTGCGGACGCTTCTGAAAAAGCGATGGGTGCTTCTGTGTACATTTGTGTACAACCGGCTTCCGGACCAAATGAAGTCAATTTAATTGGTGCCAAAAGCAAGGTCGCGCCGCTCAAGGTTGTTTCCTTAGCCCGCCTAGAGCTTTGTGCTGCTGTATTATTATCGAAACTGTTTCGATTTGTTATCGACACTGTTTCTCCCCGCTGTCATGTCGACGAAATTTTCGCGTTTACTGATTCGACAGTGGCCCTCCATTGGGTTCACTCGTCTCCGCATCGCTTTGATACTTTCATTGCGAACCGCATCGCACAAATACAGAACAACCTTGACCCCAAACACTTCTACCATTGTGAAGGTACGCAGAATCCCAGCGACTGCTTGAGTCGTAGTCTCACACCCGCTCAATTATTGAATCACCCGCTGTGGCTCTATGGCCCTACACGGGCTCGTGATAACGTCCATACATGGCCCATCAACCGCTTCACGTTTGATCCCGGAGAACCGGAACCTTTAACGCCTTCGCATTTTTTAACTCTCGGACCGCTAGACTCCTTTCATTCTGATCCGCGTTTAGATTCGGTAGATTTAGTTCGCAATAAACGACTTGTCGATGACATTGTTCAGAGATTCTGGAATCGCTGGAGGCGTGAGTACCTAAACACGCTTCAAACGCGCGCTAAATGGAACACCAAATTTAATCCGGTGACTAAAGGTACTGTTGTCCTTCTTAAAACAGAAAACTCACCGCCTTTACAATGGCCAATGGGTATAATTGAAGAAATAATGCCTGCCTCGGACGGGGTCGTTAGAGTAGTCAGAGTGCGCACACAAAACGGCACCTATCTTCGACCTGTAGTAAAACTTTGTGTTTTACCTTCCCAATAA
Protein
MYHFNRVCFGLRCSPYLAMKTVKRLARDETDFPIASEIASDHLYMDDLGVSVDTPENGIQLAHDLIELFKRGGFYLVKFVSNSPEVLKSIPQANRLSSKIEFDKEDNMKLLGLIWSPVEDEFSIAIKFNPQAKCTKRLMLSTIAKLWDINGFCAPVILHAKLLIKALWIAQIDWDVEPPSDICAAWKRFLNELPALQDFKIPRFVGIVPESRVILLGFADASEKAMGASVYICVQPASGPNEVNLIGAKSKVAPLKVVSLARLELCAAVLLSKLFRFVIDTVSPRCHVDEIFAFTDSTVALHWVHSSPHRFDTFIANRIAQIQNNLDPKHFYHCEGTQNPSDCLSRSLTPAQLLNHPLWLYGPTRARDNVHTWPINRFTFDPGEPEPLTPSHFLTLGPLDSFHSDPRLDSVDLVRNKRLVDDIVQRFWNRWRREYLNTLQTRAKWNTKFNPVTKGTVVLLKTENSPPLQWPMGIIEEIMPASDGVVRVVRVRTQNGTYLRPVVKLCVLPSQ

Summary

EMBL
GAIX01013989    JAA78571.1    APCN01002077    GBHO01044644    JAF98959.1    GBHO01044645    + More
JAF98958.1    GEZM01054789    JAV73399.1    GBHO01044643    JAF98960.1    GBBI01004276    JAC14436.1    GALX01004947    JAB63519.1    GDHC01006469    JAQ12160.1    GEBQ01015458    JAT24519.1    GEBQ01000825    JAT39152.1    GEBQ01028569    JAT11408.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    ABLF02004035    ABLF02004036    ABLF02004037    ABLF02004038    ABLF02008018    ABLF02008020    ABLF02012635    ABLF02061171    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GEZM01085145    GEZM01085143    JAV60187.1    LBMM01024307    KMQ82592.1    JYDJ01000015    KRX49522.1    LBMM01009496    KMQ88090.1    GALX01000776    JAB67690.1    GEZM01054766    GEZM01054765    JAV73410.1    JAV73413.1    LBMM01007770    KMQ89434.1    GECZ01008071    JAS61698.1    GECZ01006169    JAS63600.1    GEBQ01005223    JAT34754.1    LBMM01005079    KMQ91831.1    AJWK01017851    GAMC01009674    JAB96881.1    GDHC01014057    JAQ04572.1    KQ971357    EFA07702.1    GBHO01039838    GBHO01006034    JAG03766.1    JAG37570.1    GGMR01002024    MBY14643.1    LBMM01012238    KMQ86334.1    LBMM01009403    KMQ88162.1    GEBQ01018232    JAT21745.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    GDHC01018192    JAQ00437.1    ABLF02005684    LBMM01009688    KMQ87939.1    LBMM01009551    KMQ88039.1    ODYU01004932    SOQ45315.1    GAMC01021577    GAMC01021573    JAB84982.1    ABLF02017056    ABLF02041863    LBMM01016286    KMQ84479.1    ABLF02008594    GGMR01005823    MBY18442.1    LBMM01013710    KMQ85515.1    LBMM01011244    KMQ86944.1    LBMM01011245    KMQ86943.1    LBMM01010417    KMQ87475.1    DS497760    EFA13225.1    AJWK01014281    LBMM01016285    KMQ84480.1    LBMM01011492    KMQ86800.1    LBMM01009442    KMQ88136.1    LBMM01012188    KMQ86362.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    ABLF02066034    GBHO01044316    JAF99287.1    LBMM01009746    KMQ87900.1    LBMM01009898    KMQ87805.1    LBMM01006490    KMQ90572.1    LBMM01009964    KMQ87756.1   
Pfam
PF17921   Integrase_H2C2        + More
PF05380   Peptidase_A17
PF18701   DUF5641
PF03564   DUF1759
PF00665   rve
PF05585   DUF1758
PF00078   RVT_1
Interpro
IPR041588   Integrase_H2C2        + More
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR040676   DUF5641       
IPR005312   DUF1759       
IPR001584   Integrase_cat-core       
IPR036397   RNaseH_sf       
IPR008737   Peptidase_asp_put       
IPR000477   RT_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001878   Znf_CCHC       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR036875   Znf_CCHC_sf       
IPR000727   T_SNARE_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
511
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.12842
Exp number, first 60 AAs:
0.00052
Total prob of N-in:
0.00745
outside
1  -  511
 
 

Population Genetic Test Statistics

Pi
51.733429
Theta
67.763289
Tajima's D
-1.233469
CLR
0
CSRT
0.101444927753612
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号