SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07668
Annotation
PREDICTED:_uncharacterized_protein_LOC101738890_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.167
 

Sequence

CDS
ATGAAATCCCTAGGAATGATAGATGCAACATTTGATTCGTTAAAACACCAGTTCCACCTTGTCCCTGACTTGGACTTTCCATATGACGGCATAATAGGTAATGACTACTTCACCACACTTAACTGCAAAATAGATTACACTGAAAATACATTAGTTGTCAACAACACTAAACTTAATCTAAAATTCACTGATCCAATTTATACTATTCCTCCTAGGACCGAAACCGTTATCGAATGCTCTGTACTAAATCCAGAAGTTAAAGAGGGTCTTATTTTAGACCAAAATCAGATCAGTTCTCTTCTCATCGCTAACTGCATAGTAAAAGTTAAATCAAACTCAAGAATAAATATATCAGTTGTGAATACTTCCGAATATCCATTACGTGTAAATTCAAACTTAAAACTCAAATTGATACCATTTGACGAAAAAGCTAATAGCAAAATTTTCTATACTTCCGTCAGTGACAAAGAAAGTCAAAACAATGCTTTAGAGAGAGCCGAAGCAGTTCTAGACCTATTACGTGTCTCACACTTGAATGTCGAAGAAAAAGATGCTCTCTATGATCTATGTGCGACTTATTCTGACATCTTCCATTTACCCAATGACAAATTGACTTGTACCGACGCGATACTTCATGAAATAACCACTTCTTCCTCTGTCCCTATTAATACGAAATCGTATAGATTCCCTGAAGTGCACAAACAAGAAGTCCAATCCCAAATTACTAAGATGTTGGATGAAGGGATCATTAAACCTTCCACATCTCCATGGTCCTCTCCAATCTGGATAGTCCCCAAGAAAATCGACGCATCTGGTCAACGCAAATGGCGAGTGGTGATCGACTACCGTAAGCTCAACGACATCACTATAGGTGACGTTTATCCAATCCCTAATATTTCCGAAATATTGGACCAACTAGGTAAATCTAAATATTTCAGCACATTAGACCTTGCTTCCGGTTTCCATCAAATTAGGATGTCTCCACAAGATGCTCCTAAAACCGCTTTCTCAATTCCTCAAGGTCACTTCGAATTCACACGCATGCCTTTCGGACTGAAAAACGCCCCAGCTACTTTTCAGAGACTCATGAACTCTGCCCTCTCAGGCCTACAAGGCATACAATGCTTCGTATATTTGGACGATATAGTCGTCCATTCATTTGACCTAGAAAAACATATCCTCAACCTTTCCAATATTTTCGACAGGCTCCGTACTTTTAATTTAAAACTTCAACCCGACAAATGTGAATTTCTCCGTAAGGAAGTATCTTACCTTGGTCACATAATAACCGATGAAGGTGTAAAACCTAATCCGGAAAAAATCAAAGCCGTGCAACAATTTCCTACTCCCAAATCTCCCAAAGATATAAAATCCTTCCTTGGACTCGTATCATACTACAGAAAATTTATCCCAGATATATCCAAAATAGCTAAACCCCTTACTAATCTCCTAAAAAAGAATGTCCCGTTCCTTTGGCAAAATGAACAGCAACTCGCCTTTGAAACCTTGAAAAACGCACTCATAACAGCTCCACTACTAGCCTATCCTGACTTTAACAAACCATTTGTACTTACTTGTGACGCATCCGATTATGCAATCTCCGCCATTTTATCCCAGGGTGAAATAGGGAAGGATCGCCCCATTGCCTATGCATCACGAACCCTAAACAAATCCGAATTAAATTATTCCGTTTCTGAAAAAGAATGTTTGGCCATTATATTCGGCACCAAAACGTTCAGACCATATCTATATGGACATCGTTTCAAAATTGTTACAGACCATCAACCGCTTAAATGGTTATTCAGTCACAAAGATCCGTCTTCCAAATTAATCCGATGGAGACTCAAACTAGAGGAGTTTGATTATGAAATTGAATATAAAAGGGGCAAAATCAATCGAAACGCGGACGCTTTGTCCCGTTTTCCTGTAAACCCAATAATCGAAAACCAACCTCAATCTTCCACTTCTGGCACCGCCAATCCTAATCTCCAAGAATCTGAGATTCCTTCCGACCTTCTAGAAGACCTTACCGAACTTGGTGCCTTAGATATCAGTCCAAGCCAGGGCGTCGACTTCAGCCCTCTCTATCCACCTTCCGAATCAAGTGATCCAAACCCTCCACCTTTGCCAGATCCTGTCAACGACACACACGAACCGACACCTGAAATAAATTCCAACATCACAGACGACTACTCGACCTTTCTAAAATCCTTCACAGACGAGAACCAAACTTTTAATACTCAAGTTAAAGAACACAACGAAAGTCTCCTTAAAAGCACTTCAAAAACTATTTTAATCCCTGTCTCCATTGATTTCGATGACTCAAACCCTTATCTTGAAGACATACTTTCCTCATTAGAAGACCGTACAATCCTTGACAATGAACGTGAACTTCATAGTTTTATGAAAATAGAGCTTAAAGGAAAAGTTTTTTATCTTCTATTTACGAAGGTTTACTATTTCGACAATTGCACTTACCCAGACATATTCAAGACCCTTAAGTCCGCACGAGACGACATCATACTCCAAGGTGACATAAATGATATTGCCATTTCCGACTTCAAGAGCTCATTTGAACAACACTCTTTTGTGAAAATTTATGGGATACTAGTTTACCTATTCAACAACACAAACACTACAGTAAACATACACCATGATACTATCATCCATCCTGTCCCTACCGAAATTTCTAGAATACTGAAAGAAAACCACGATATTCCGATCGCCGGTCATCTCGGTTCCAATCGAATGTTAAGCAGAATTAAAGAACGTTATCATTGGAAAAATATGCGCTCAGACATCGAAGACTACGTCAAGAATTGCAAACTGTGTCAATCAAACAAAGCTCTGCGCAAGATCAACAAATCTCCTATGCAAATCACCACTAGCTCTACTCGTCCCTTTGAGAGGATTAGCCTCGATCTCGTTGGTCCCTTGCCTGAGGCTGGCCTTTCAAAGCTTAAGTTTATTCTAACTCTTCAAGACGATTTAACCAAATTTTCTATTGCATACCCAATCTCTAATGCTACCGCAGAGGAGTCCTGCGAATGCTTAGTCCACTTCATTTCCTTATTTGGTATCCCGAAATCAATACTCACTGATCAGGGAACCAACTTCACTGCCGAACTCTTTAAAGTAACGTGTCAATTTTTAAAAATTAAGCAACTCTGGTCCTCTCCCTACCATCCCCAAACGCAGGGCGCCCTGGAAAGAAGTCACTCAACACTAAAAGAATACCTTAAGTCTTATGTGAATGATAATCAGACAAACTGGCATAAATTTGTATACACAGCTATGCTCACCTACAACAGTACAATCCACACCACTACTCAATTTACACCTTACGAACTCGTCTTTGGTCATAAACCATATATACCCGATTCCGTCTTCGATTTACGATCAGATGTCACGTACCCTGAATATCTTAAGATGCTTAGTCACCGCCTCAAAATATCAAGAGAAAAAGCTCTACAAAATATTAATGTCTCTAAAGAAAAGTCCAAGACATATTATGACAGACACTCTCGCCCCGTCCAATACAAGGTTGGAGATTACGTGTATTTAAAGAATCATCTCCGACTTAGAAAGGCCCTATCACCGATGTGGAAAGGTCCTTACAAAGTTGTAAAAATTCACGGCAATAACACCCTTTCCCTCCTGAATAGGATATTTGAATCTTCAGAATGCGAAAACATATTACAACCTCTCGAAGTTCGTTTCTCTGATATGCTGAGAGATTTCGATTCTGTTTCTCACCTCGTTGCACGAAGAACAAAACGCTCAGCGTGGTTCGGTGGTGTCGGGTCAGTATTCAAAACCCTGTTCGGCACAGTAGACGAAAATGATGCGATCCGTTATGATAACGCCATTCGAGTATTACAAGATGATCAAAAAGATCTAGCAGAAAATATAAAACAAGGTATCATTGAAATACCCATGGGTTGCACCGGATATTGCCGTGGTATTGAATTATTATCTAAAGAAACTATTCAGATTAATGTTACACATATTAAAATTGATTTTGATATTATAAGTAATCTTAATTTAAGCGAATCCAAGTTCTCCAATGTAATGCCAAAATTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCATCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCTAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGCACAAATCACTCATGCGTTCAACAGGTGCACAGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAGAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCTGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGTCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATTCTAGGGGCAGGCTTAGGGACCCCGGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAA
Protein
MKSLGMIDATFDSLKHQFHLVPDLDFPYDGIIGNDYFTTLNCKIDYTENTLVVNNTKLNLKFTDPIYTIPPRTETVIECSVLNPEVKEGLILDQNQISSLLIANCIVKVKSNSRINISVVNTSEYPLRVNSNLKLKLIPFDEKANSKIFYTSVSDKESQNNALERAEAVLDLLRVSHLNVEEKDALYDLCATYSDIFHLPNDKLTCTDAILHEITTSSSVPINTKSYRFPEVHKQEVQSQITKMLDEGIIKPSTSPWSSPIWIVPKKIDASGQRKWRVVIDYRKLNDITIGDVYPIPNISEILDQLGKSKYFSTLDLASGFHQIRMSPQDAPKTAFSIPQGHFEFTRMPFGLKNAPATFQRLMNSALSGLQGIQCFVYLDDIVVHSFDLEKHILNLSNIFDRLRTFNLKLQPDKCEFLRKEVSYLGHIITDEGVKPNPEKIKAVQQFPTPKSPKDIKSFLGLVSYYRKFIPDISKIAKPLTNLLKKNVPFLWQNEQQLAFETLKNALITAPLLAYPDFNKPFVLTCDASDYAISAILSQGEIGKDRPIAYASRTLNKSELNYSVSEKECLAIIFGTKTFRPYLYGHRFKIVTDHQPLKWLFSHKDPSSKLIRWRLKLEEFDYEIEYKRGKINRNADALSRFPVNPIIENQPQSSTSGTANPNLQESEIPSDLLEDLTELGALDISPSQGVDFSPLYPPSESSDPNPPPLPDPVNDTHEPTPEINSNITDDYSTFLKSFTDENQTFNTQVKEHNESLLKSTSKTILIPVSIDFDDSNPYLEDILSSLEDRTILDNERELHSFMKIELKGKVFYLLFTKVYYFDNCTYPDIFKTLKSARDDIILQGDINDIAISDFKSSFEQHSFVKIYGILVYLFNNTNTTVNIHHDTIIHPVPTEISRILKENHDIPIAGHLGSNRMLSRIKERYHWKNMRSDIEDYVKNCKLCQSNKALRKINKSPMQITTSSTRPFERISLDLVGPLPEAGLSKLKFILTLQDDLTKFSIAYPISNATAEESCECLVHFISLFGIPKSILTDQGTNFTAELFKVTCQFLKIKQLWSSPYHPQTQGALERSHSTLKEYLKSYVNDNQTNWHKFVYTAMLTYNSTIHTTTQFTPYELVFGHKPYIPDSVFDLRSDVTYPEYLKMLSHRLKISREKALQNINVSKEKSKTYYDRHSRPVQYKVGDYVYLKNHLRLRKALSPMWKGPYKVVKIHGNNTLSLLNRIFESSECENILQPLEVRFSDMLRDFDSVSHLVARRTKRSAWFGGVGSVFKTLFGTVDENDAIRYDNAIRVLQDDQKDLAENIKQGIIEIPMGCTGYCRGIELLSKETIQINVTHIKIDFDIISNLNLSESKFSNVMPKFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHSLTEHILVGLNRPKPLYTGALFFDVARAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPLTHLALFADDTTVYYSSRNKSLIAKKLQSAVLALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNSRGRLRDPGNRTRRTRQRGRRAT

Summary

Uniprot
ProteinModelPortal
PDB
4OL8     E-value=4.89572e-68,     Score=661

Ontologies

Topology

Length:
1926
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.46984000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1926
 
 

Population Genetic Test Statistics

Pi
223.81942
Theta
178.598412
Tajima's D
1.539458
CLR
161.616189
CSRT
0.796310184490776
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号