SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07647
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.352 Nuclear   Reliability : 2.028
 

Sequence

CDS
ATGGGAGTGCCAGACAGACTCGTGCTCATCATACAAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTACTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCTCTCCCGACTAAGCGCGTCAACACCTCCGCCTCCGCCATTCGCCCAATCACGATGTTCGACCAGCCCATACCGTAG
Protein
MGVPDRLVLIIQDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTKRVNTSASAIRPITMFDQPIP

Summary

EMBL
KC165845    AFY12622.1    AB055391    BAB21761.1    AB018558    BAA76304.1    + More
U07847    AAA17752.1    KQ459580    KPI99178.1    KQ459259    KPJ02068.1    KQ459265    KPJ02064.1    AF081101    AAC72919.1    AF081103    AAC72921.1    NEVH01000280    PNF43672.1    NEVH01005938    PNF38077.1    NEVH01001355    PNF42855.1    NEVH01019080    PNF22876.1    NEVH01023962    PNF17612.1    NEVH01020071    PNF21969.1    NEVH01003017    PNF40781.1    NEVH01010546    PNF32261.1    NEVH01007443    PNF35684.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01018383    PNF23463.1    NEVH01023961    PNF17613.1    NEVH01006754    PNF36554.1    NEVH01019964    PNF22161.1    NEVH01007838    PNF34986.1    NEVH01009134    PNF33528.1    NEVH01002716    PNF41415.1    NEVH01027074    PNF13841.1    NEVH01026154    PNF14491.1    NEVH01014858    PNF27387.1    NEVH01005277    PNF39135.1    NEVH01011985    PNF31054.1    NEVH01017470    PNF24199.1    NEVH01019376    PNF22596.1    NEVH01017559    PNF23833.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    NEVH01021205    PNF19912.1    ABLF02023911    ABLF02040650    ABLF02040651    ABLF02056776    ABLF02056778    ABLF02028535    ABLF02028545    ABLF02038199    ABLF02038200    ABLF02038201    ABLF02038202    ABLF02038205    ABLF02008933    ABLF02025082    ABLF02039175    ABLF02041809    NEVH01002556    PNF42024.1    NEVH01026119    PNF14565.1    ABLF02016494    ABLF02066976    ABLF02058433    GGMR01019198    MBY31817.1    GGMS01012362    MBY81565.1    KK117880    KFM71667.1    GGMR01000167    MBY12786.1    ABLF02003961    ABLF02059872    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02029291    ABLF02014862    ABLF02014866    ABLF02061908    ABLF02030319    ABLF02030320    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02042518    ABLF02057746    ABLF02007289    ABLF02042519    GGMR01004661    MBY17280.1    ABLF02026876    GEDC01006530    GEDC01000386    JAS30768.1    JAS36912.1    ABLF02016634    GBYB01008290    JAG78057.1    ABLF02034467    ABLF02037507    ABLF02041173    ABLF02054117    GFTR01007904    JAW08522.1    ABLF02063914    ABLF02036077    ABLF02036081    ABLF02021177    ABLF02027367    ABLF02066338    KQ972290    KYB24559.1    GEDC01012749    JAS24549.1    GFTR01008038    JAW08388.1    ABLF02008605    ABLF02008608    ABLF02008609    ABLF02008610    ABLF02017023    KQ973427    EFA13419.2    GEBQ01017345    JAT22632.1    ABLF02021181    ABLF02027365    ABLF02027369    ABLF02052813    ABLF02061832    GEZM01008457    JAV94772.1    ABLF02036084    KQ973342    KXZ75569.1    KQ973073    KXZ75680.1    ABLF02027009    ABLF02027012    GGMS01004685    MBY73888.1    ABLF02033757    KL813758    KFM83187.1    KQ971729    KYB24751.1    GGMS01017914    MBY87117.1    KQ973363    EFA13335.2    KQ971327    EFA00927.1    NEVH01013277    PNF28984.1    ABLF02004189    ABLF02005775    ABLF02015592    ABLF02057149    ABLF02058897    GFTR01008260    JAW08166.1    GGMS01000625    MBY69828.1    ABLF02010251    ABLF02035981    KK113014    KFM59099.1    ABLF02010352    ABLF02010355    ABLF02058900    GALX01005359    JAB63107.1    GBGD01000389    JAC88500.1    GFTR01008271    JAW08155.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
PF13843   DDE_Tnp_1_7
PF10551   MULE
PF13358   DDE_3
PF17917   RT_RNaseH
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR036875   Znf_CCHC_sf       
IPR006579   Pre_C2HC_dom       
IPR029526   PGBD       
IPR018289   MULE_transposase_dom       
IPR013083   Znf_RING/FYVE/PHD       
IPR038717   Tc1-like_DDE_dom       
IPR001878   Znf_CCHC       
IPR041373   RT_RNaseH       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
152
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02323
Exp number, first 60 AAs:
0.02254
Total prob of N-in:
0.03704
outside
1  -  152
 
 

Population Genetic Test Statistics

Pi
22.847709
Theta
17.118992
Tajima's D
-0.641197
CLR
0.293369
CSRT
0.214689265536723
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号