SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07637
Pre Gene Modal
BGIBMGA012989
Annotation
Yokozuna_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.761
 

Sequence

CDS
ATGGGCCCAGAGTACCCAAAGTGCCTAGAAATTTCGCAAGAGGTAGCGTCAAGTGGCGTTATAGAATTAAAACAAAAAACTGCTGATGCGGCTGCAAAAGCCTTAATAGTAAAATGTGTACCCGATAAGTACTTGGACATCATAAAAGATGCAACAACTAGCTACACAATGTTAGCCAGTCTGGATAAAGTTTTTGAGAGAAAAGGTATTTTCACTAAATTACACTTGCGAAGAAAGTTATTGTCTCTTAAGCTGAGGGATGATAAATTGGAAGACTATTTCATGAGATTTGAAAGTCTGATTAGAGAAATAGAAAATATTGATAAAAAGATGGATGAAGAAGATAAAATATGTTATTTGCTGACGGGTATGTCGGAAAAGTACAACACAGTGATAACTGCTATTGAAACAATGTCTGCAGATAAAATTGACATGGAGTTTGTCAAGGCTCGGTTATTGGACGAAGAACTCAAACTGAATAATAAAGGTGAAGAGTATAATGATACAAAGAATGATGTAAGTTTTACTGCCTCAAGTGTAGAATGTTATCGTTGCCACAAAAAGGGCCATTTTGCACGTGAATGTAGAAGCAGAGGTCGTGGCTATTCAAGGAGAAACATTAATGATAAAGGTATATGTGGTAAAAACAGAACTGAAGAACAAAATAATATGACAGAAAGCATCCCAGAGAATAAATATAATTTTCTAGCAATAACGGAGTGTAATCTAAGTAAAGAAGACAAATTTATAGAATTTATAATAGATTCAGGAGCTACAGAAAATCTTATCAAGGAAGAATTGGAGAAATACATGTATGAAATTAAGAAACTACCAAATAAAATAAAAATTAAGATTGCAAATGGAGAAATATTAGAGGCTGACAAGAAAGGAAAGATAACCATAAGAGATAAAAATAATAATACTATAAATATAGAAGCGTTAATGGTCCCAGGGATTTATCATAATATAATATCTGTAAGAAACTTAAATATGAAAGGAAATAAAGTTGTTTTTACAAAATTTGGAGCACAAATAATAAATGGAAGAAAAGTCTTAAAATGTTCAGATAGAAATGGTTTATATATAGTACAAGGCGAAATAATACTAATAGAAGAAGCGAACTCAAGTGTACAGCAAGACAAAAATATTTGGCACCAACGTCTCGGACACTTAAATAGGAAATCATTAAAAATTATGGGTTTACCTGTGTCTGATGAAACATGTGGTCCTTGCATGAAGGGAAAATCTACTCGTTTACCATTCTATCCAGTTGACAGGCCAAGAAGTAGAAAAATAGGAGAATTATTGCATACAGATATTGGAGGTCCTGTATCACCAATTTCTTATGATGAAAAACAATATTACCAGACCATAACTGATGATTTTTCTCATTTTGTGACTGTTTATCTATTAAAGAATAAATCTGAAGCCACAAGAAATTTAATAAATCATATAAAGGAGTTAGAAAGACAAAAGGAAACTAAAGTTAAACGCATAAGATGTGATAATGGTGGAGAGTTCACCGCTGGCTGTTTGAAGCAATTTTGTATGGAAAATGGAATTATAATAGAGTATAGTCAACCTTACACACCACAACAAAATGGTGTGGCAGAGAGGCTAAACAGAACATTACTAGATAAGTCAAGAACTTTATTAAGTGAAACTGGATTACCTAAATATTTGTGGTCTGAGGCTATAATGTGTGCAGCATATCAATTGAATCGATGCCCATCAAGATCTATAAAGTATAAGATACCAGCTGAAATATACTACGGACTAGAAAATGTTAACTTGAACAAGTTAAAGGTATTTGGTTCTAAAGCATGGTATACGTGTGTCCCACAGAATAAGAAATTAGATAATAGAGCTGAAGAAGCCATTATGGTTGGCTATGGCAAACAAGGTTATAGATTATGGAATCCAAAAACAACAGAAATAATATTCTGCAGAGATGTCAAGTTTGATGAAAAGTACTATGAACATAAAAACAGTATTAAAAATAACAACTATATTTATTTACCAGAAGAGGACACACAAAATGAAGTTATGTGCAATGATAAAAATAAAATTGAGGAAGAAAAAGTAATACAGAAAAATGAAGAGACAGACACAAAAAGAACTAGATCAGGAAGGATAATAAAGCAACCTGATTATCTAAAGAATTTTGGGACGTACACAGCATATTGTTACTTAGTGTGTAATGACCCAGAAAGCTATGAAGAAGCGATAAAAGAAGTTTCATGGAAAGAAGCGATACATAAGGAATTAGCAGCACTTGAGAACTTACAAAGCTGGGAAGAGACTAAACTACCGAAAGGAAAATTAGCTATAGACACTAAGTGGGTTTTTAGAACGAAAGACGATGGCACTAAGAAAGCCAGATTAGTCGCTCGAGGTTTTCAAATAAAAAATTATGAGAATGAAATATTCTACAGTCCTGTAGTAAGAATGTCTACGATAAGAGCATTTTTTGTAAAAGCTATCCAAGAAGGATACAAATTAAGGCAATTGGATATTCCTACAGCCTTTCTCAATGGATTTCTTGATAGTGAAGTTTATATAAAAATACCCAAAGGCAAAGAAAACAAAGATGGAATAGTTTTGAGGTTAAAGAGAGCATTGTATGGATTAAAAGAAAGCCCTAAATGCTGGAACATGAGATTTGATGAATTTGCAAGAAAGAATGGATTGATACAGATACAGAAAAAAATTATTAATAAATTGAAGCAAGAATTTAAAGCTAAAGATTTAGGACAGATTGAGAAATATCTTGGTATGGAAATTAAACAGGAAGAAAGTAAATTAACGATTAAACAAGAAAAGATAATTGAGAAGATACTAGAAAAATTTGGAATGTCAGAATGTAAAGGTATAGGAACACCTATGGAGGTAAATTTTCAAATAAACAAAAATGAGAAGATTATTGATGTACCATATCGACAACTCATAGGAAGCATAATGTATTTGGCTACTATGTCCAGACCAGATCTGCAGTTTGCTGTATCATATCTTAGCAGATACCTAGACTGTCCTACTCAACAGACTTGGAAAGCTGGAAAGAGAATTCTGCAATACCTAAAAGCTACAAAAGACAAAATGTTAGTTTTTCAAAAAAGGAATAATCTAGATGTGGATTTATGTGCATATTCAGACTCTGATTGGGCAGGTGATATTGTTGATCGCAAAAGTGTCAGTGGGGGTATCATAATGTGTAGTGATAATCCTGTATTTTGGTACTCTAGAAAACAAAGTTGTGTTGCATTATCGACAGCAGAATCAGAGTACATTGCTAGTGCTTGTTGTGCTCAAGAGTTAGTGTATTTGAAAGGTGTACTGTGTGATTTTGGATATGAATGTAAATTGACTTTATTTATGGATAATAAGGGAGCAATATGTTTAGCGAAGTCAAATGAAAACTCTAAAAGGAGTAAGCATATTGATATAAGGATGCACTATATTAAGGACTTGGTGAGGAATAATGTATTAGATATTGAATATGTGTCATCTGATAAAAATATTGCTGATATTTGTACAAAATCTTTATGCAAAGAAAAGTTTGTATTTTTTAGAAGTTTGTTACTAAAGTAA
Protein
MGPEYPKCLEISQEVASSGVIELKQKTADAAAKALIVKCVPDKYLDIIKDATTSYTMLASLDKVFERKGIFTKLHLRRKLLSLKLRDDKLEDYFMRFESLIREIENIDKKMDEEDKICYLLTGMSEKYNTVITAIETMSADKIDMEFVKARLLDEELKLNNKGEEYNDTKNDVSFTASSVECYRCHKKGHFARECRSRGRGYSRRNINDKGICGKNRTEEQNNMTESIPENKYNFLAITECNLSKEDKFIEFIIDSGATENLIKEELEKYMYEIKKLPNKIKIKIANGEILEADKKGKITIRDKNNNTINIEALMVPGIYHNIISVRNLNMKGNKVVFTKFGAQIINGRKVLKCSDRNGLYIVQGEIILIEEANSSVQQDKNIWHQRLGHLNRKSLKIMGLPVSDETCGPCMKGKSTRLPFYPVDRPRSRKIGELLHTDIGGPVSPISYDEKQYYQTITDDFSHFVTVYLLKNKSEATRNLINHIKELERQKETKVKRIRCDNGGEFTAGCLKQFCMENGIIIEYSQPYTPQQNGVAERLNRTLLDKSRTLLSETGLPKYLWSEAIMCAAYQLNRCPSRSIKYKIPAEIYYGLENVNLNKLKVFGSKAWYTCVPQNKKLDNRAEEAIMVGYGKQGYRLWNPKTTEIIFCRDVKFDEKYYEHKNSIKNNNYIYLPEEDTQNEVMCNDKNKIEEEKVIQKNEETDTKRTRSGRIIKQPDYLKNFGTYTAYCYLVCNDPESYEEAIKEVSWKEAIHKELAALENLQSWEETKLPKGKLAIDTKWVFRTKDDGTKKARLVARGFQIKNYENEIFYSPVVRMSTIRAFFVKAIQEGYKLRQLDIPTAFLNGFLDSEVYIKIPKGKENKDGIVLRLKRALYGLKESPKCWNMRFDEFARKNGLIQIQKKIINKLKQEFKAKDLGQIEKYLGMEIKQEESKLTIKQEKIIEKILEKFGMSECKGIGTPMEVNFQINKNEKIIDVPYRQLIGSIMYLATMSRPDLQFAVSYLSRYLDCPTQQTWKAGKRILQYLKATKDKMLVFQKRNNLDVDLCAYSDSDWAGDIVDRKSVSGGIIMCSDNPVFWYSRKQSCVALSTAESEYIASACCAQELVYLKGVLCDFGYECKLTLFMDNKGAICLAKSNENSKRSKHIDIRMHYIKDLVRNNVLDIEYVSSDKNIADICTKSLCKEKFVFFRSLLLK

Summary

EMBL
AB014676    BAA74713.1    GDHC01015802    JAQ02827.1    GBHO01027564    JAG16040.1    + More
GDHC01019310    JAP99318.1    GBHO01004832    JAG38772.1    GEDC01012841    GEDC01000503    JAS24457.1    JAS36795.1    GBHO01035173    JAG08431.1    GDHC01007058    JAQ11571.1    GEZM01072005    JAV65635.1    GEZM01028916    JAV86196.1    GBHO01002761    JAG40843.1    GFTR01008662    JAW07764.1    JXUM01155348    KQ572178    KXJ68066.1    JXUM01025857    KQ560736    KXJ81076.1    LJIG01022881    KRT78250.1    GEHC01000878    JAV46767.1    GBBI01004033    JAC14679.1    ABLF02041793    KF740825    AIC77183.1    JXUM01011189    KQ560325    KXJ83029.1    JXUM01136904    KQ568499    KXJ68982.1    KQ483843    KYP40337.1    CM003606    KYP69041.1    KQ483623    KYP44533.1    CM003608    KYP66220.1    GEZM01032204    JAV84770.1    GEDC01029908    JAS07390.1    LBMM01012492    KMQ86193.1    AC073555    AAG60117.1    OIVN01006211    SPD27863.1    OIVN01006466    SPD33659.1    AC007259    AAD50001.1    OIVN01002473    SPD03944.1    AC079604    AC079131    AAG50698.1    AAG50765.1    KYP68607.1    GBHO01040663    JAG02941.1    AL137898    CAB71063.1    OIVN01001931    SPC99063.1    GEHC01000959    JAV46686.1    KQ485638    KYP31826.1    CM003610    KYP61818.1    KYP63036.1    KQ483890    KYP39660.1    KYP68287.1    AP002064    BAB01972.1    KQ460882    KPJ11482.1    GFTR01008327    JAW08099.1    KQ484324    KYP35753.1    OIVN01000486    SPC81000.1    OIVN01001906    SPC98838.1    AY009101    AAK12626.1    ASHM01014140    PNX96091.1    PDCK01000045    PRQ17740.1    KQ460297    KPJ16236.1    DF973299    GAU24969.1    KQ484038    KYP38095.1    ASHM01015075    PNX96991.1    GBHO01024362    JAG19242.1    KK112142    KFM56833.1    KF303287    AGW47867.1    FJ544856    ACL97386.1    KYP66838.1    CM001883    EOY11267.1    FJ544853    ACL97384.1    AM451478    CAN80930.1    KQ483456    KYP50361.1    FJ544851    ACL97383.1    KQ483853    KYP40164.1    OIVN01000279    SPC77544.1    KQ484186    KYP36645.1    OIVN01006353    SPD31284.1    ASHM01002084    PNY07765.1    NKQK01000002    PSS35035.1    DF973742    GAU39052.1    OIVN01003431    SPD11153.1    OIVN01006155    SPD26398.1    CM003607    KYP67664.1    OIVN01001308    SPC92446.1    KQ483417    KYP53032.1    OIVN01004651    SPD18552.1    CM003613    KYP54398.1    KQ483702    KYP42748.1    OIVN01005669    SPD23557.1    OIVN01003424    SPD11127.1    FJ544854    ACL97385.1    AM433482    CAN69340.1    NWSH01002292    PCG68657.1    PCG68658.1    PSQE01000003    RHN71246.1    AC149291    AAT38758.1    KQ485623    KYP31853.1    GAKP01015342    JAC43610.1    GDHC01007678    JAQ10951.1    CM007892    OTG31811.1    OIVN01002424    OIVN01005946    SPD03496.1    SPD24589.1    AM447500    CAN74198.1    LXQA010000987    MCH80374.1   
Pfam
PF00665   rve        + More
PF07727   RVT_2
PF13976   gag_pre-integrs
PF00098   zf-CCHC
PF13961   DUF4219
PF13358   DDE_3
Interpro
IPR036397   RNaseH_sf        + More
IPR039537   Retrotran_Ty1/copia-like       
IPR001584   Integrase_cat-core       
IPR013103   RVT_2       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR025724   GAG-pre-integrase_dom       
IPR025314   DUF4219       
IPR038717   Tc1-like_DDE_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D
PDB
5UOQ     E-value=2.75137e-07,     Score=135

Ontologies

Topology

Length:
1195
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00465999999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00020
outside
1  -  1195
 
 

Population Genetic Test Statistics

Pi
153.613279
Theta
164.190254
Tajima's D
-1.261702
CLR
129.351986
CSRT
0.0920953952302385
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号