SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO07618
Pre Gene Modal
BGIBMGA012959
Annotation
hypothetical_protein_[Piscirickettsia_salmonis]
Location in the cell
Mitochondrial   Reliability : 1.025 Nuclear   Reliability : 1.602
 

Sequence

CDS
ATGCAGGCACCGATCCTAATAGGTACAGACGTTTTAAATCGTGGTGGAGTCGCCTATATACGAACAAATGATTCTCAACGCCTAGTGAGAGTCGATCAAGTACAGGCTGTGTCGACTGCGGAGGTCGATATTGTAAAAACACCTTTGATCGGTGAGGACAAATATCGTTTATTGGCTTTGATCAAGGAATTCTCTAATACCTTTACCACCGGAACAGCGACCTCAACAGTCAACACGGGAAGCATGGAAATCAGACTTAATAGTGACGTCCCACTCGAATACTTGGGTAGACTAATTGGACAGGGACAGGTACGGCCGAGCCCAAGTAAGACCGATGCTTTAGTTAAATCCCCGAAACCAACTAATGTAAGAGAGGTTCGTCAGTTTCTGGGCCTGGCGGGCTATTTTCGAAGGTATATCGCCGGTTATGCCTCTAAAACGGCTTGTATCGCTAGATTGCTTAAGAAAGGCGAGCCTTTCAATTGGAGTGTCGAACAAGACGAGGCTCGAGACTACGTAATTAAATGTCTAACGGAAGAACCCGTTTTAGCAATATTCGATCCCAAATTGCCCACTGAGCTTCATACCGACGCCAGTGCGATAGGCTATGGTGCGATTTTGCTCCAAGAACATGAAGGAAAGCGTAAGCGAGTGGTCGGTTACTTCAGTAAATCCACACAGGGTGCAGAGTCACGTTACCACAGCTACGAGCTTGAGACTCTCGCAATCGTACGCGCATTACAACATTTTCGGCATTACTTGATCGGTATTAAATTCAAAATTGTGACCGATTGTAACTCTTTAAAATTGACAGAGCGTAAACGGGATTTATTACCGCGTGTGGCGCGCTGGTGGATTTACATGCAAGACTTCCAGTTTACGTTGGAATACCGAAAGGGTTGTTTTATGCAACATGCTGATTTTTTGAGCCGACAGCCCGTTAACGTTTTGCATATTCAAAATCCGCGTAATTGGGCGAAGATTGCTCAAACGGCTGACTTAGAGACCCAGAGCTTAATTCAAAAGCTAAGAGATGGTCAGTTAGATACTACTCGGTTTACAAAAAAAAATGATTTGTTGTACTATAAGTATGCTAGTACTGGAGAAGATTCTCGTCTTCTCTGTTTTATTCCAAAAGGACATAGACTTAGTCTGTTAAGAATCTTTCACGATGATCATGACCACATCGGAATCGACAAAACTACTGACCTAATTTTGCGTCACTTTTGGTTCCCTGGAATAAGATCGTTTGTAAAGAAATATATTGGTCACTGTATCGTATGTCTGGCACATAAAAAGGTACCTAGGGCACCTCACCTACCTATCGAATCGTGGACGAAGCCTGAGATCCCCTTCTCAGTTGTTCATACTGACGTTCTTGGACCACTAACAGAATCAAACGGTTTTAAGTACATACTCATAGTCGTTGACTCATTTTCAAAATTTTGTCTGTTGTACTCATTATACAGACAAGACACCGCAGAACTAAAGCGTGTCTTTTCCAATACCATTTCTCTCTTTGGTACTCCTTCTACAATCGTATGTGACCGAGCCAGGATGTTTGAGAGTGCACCGCTCCAAGATTGGGTAGCCGGGCTAGGTTCCTCCTTACACTTCATAACCCCGGAAATGCACCGCGAAAACGGCCAGGTCGAACGGTATTGTAGGACGGTCCTCAATATGCTGCGAATTGAGGTCAATAATAAGGGAGCTTCGTGGTCTGACGTGTTATGGAAGGTACAACTGACATTAAACATAACAAGGCATTCGACAACTCGTGCCTCACCACTGCAATTACTAAGTGGCATTGAAGGGACTACTCCGGTCTTAAGGTCTCTTGTGCGGGATGTCGCGCTTGAAAACTCTCATACGAACCGAGAAGCTTTAATGACGCTTCGGAGACAGAGAGCCTCTGAACTGCTAGCTACTAATCAACAAAACCAGGACTCTCGTGTTAACGAAGGTCGTCGGCAGCCCCGAACCTTTGCTGTTGGCAGTTTTGTCTTTGTGAACAAGGGTTCGCAAAGTACTGGGAAGTTGGACTCGGGGATGCGAGGACCATACAAGATTGTTCGAGCGCTGCCGCATCATCGGTACGAACTGGAGCTGTTGGCTGGGTCTTACGGAAAGAAGACTCAGACAGCCGCAGAACTTATGGTTCAGTGGCGTGGCGAGTGCACTCCAGCCGTATGTGAAGCATTCTTTGAAAGTAATGACGATGAATACGATGGGCACTTCTTATCCAATGAGAATGAGTCGCATGGTGATCGTGTTGAAGAGGAGCAGGAAGACCAGGTTGGGGTGGTCGAGGGAGACCAGCCTGAGGGGAACCAAGCTGACGAGGCCGTTCAGCTGTCAGGAGAGGCCGTGTTAGAGAATTTGTCACTACCCGGCCCCTCTACTCAGTGA
Protein
MQAPILIGTDVLNRGGVAYIRTNDSQRLVRVDQVQAVSTAEVDIVKTPLIGEDKYRLLALIKEFSNTFTTGTATSTVNTGSMEIRLNSDVPLEYLGRLIGQGQVRPSPSKTDALVKSPKPTNVREVRQFLGLAGYFRRYIAGYASKTACIARLLKKGEPFNWSVEQDEARDYVIKCLTEEPVLAIFDPKLPTELHTDASAIGYGAILLQEHEGKRKRVVGYFSKSTQGAESRYHSYELETLAIVRALQHFRHYLIGIKFKIVTDCNSLKLTERKRDLLPRVARWWIYMQDFQFTLEYRKGCFMQHADFLSRQPVNVLHIQNPRNWAKIAQTADLETQSLIQKLRDGQLDTTRFTKKNDLLYYKYASTGEDSRLLCFIPKGHRLSLLRIFHDDHDHIGIDKTTDLILRHFWFPGIRSFVKKYIGHCIVCLAHKKVPRAPHLPIESWTKPEIPFSVVHTDVLGPLTESNGFKYILIVVDSFSKFCLLYSLYRQDTAELKRVFSNTISLFGTPSTIVCDRARMFESAPLQDWVAGLGSSLHFITPEMHRENGQVERYCRTVLNMLRIEVNNKGASWSDVLWKVQLTLNITRHSTTRASPLQLLSGIEGTTPVLRSLVRDVALENSHTNREALMTLRRQRASELLATNQQNQDSRVNEGRRQPRTFAVGSFVFVNKGSQSTGKLDSGMRGPYKIVRALPHHRYELELLAGSYGKKTQTAAELMVQWRGECTPAVCEAFFESNDDEYDGHFLSNENESHGDRVEEEQEDQVGVVEGDQPEGNQADEAVQLSGEAVLENLSLPGPSTQ

Summary

EMBL
GDHC01004980    JAQ13649.1    GBHO01030786    JAG12818.1    GBHO01031154    JAG12450.1    + More
EF710649    ACE75273.1    GBHO01015604    JAG28000.1    GBYB01013920    JAG83687.1    GBHO01040010    GBHO01001812    JAG03594.1    JAG41792.1    LBMM01008871    KMQ88569.1    GBHO01036023    GBHO01032007    JAG07581.1    JAG11597.1    KQ971345    EFA05054.2    KQ460883    KPJ11409.1    GBRD01016821    GBRD01016818    JAG49006.1    GDHC01018907    JAP99721.1    KQ971338    KYB27888.1    KYB27887.1    ABLF02008401    ABLF02008404    GEZM01033083    JAV84424.1    GGMR01005091    MBY17710.1    GEZM01034557    JAV83728.1    GEZM01005427    JAV96179.1    LBMM01005919    KMQ91095.1    KMQ91096.1    GAMC01015907    JAB90648.1    LBMM01010976    KMQ87102.1    GGMR01015631    MBY28250.1    GEZM01098134    JAV53984.1    GEZM01051217    GEZM01051215    JAV75083.1    LBMM01011782    KMQ86633.1    GGMR01009949    MBY22568.1    ABLF02041876    GFXV01005120    MBW16925.1    GEGO01004299    JAR91105.1    GGMR01003388    MBY16007.1    ABLF02005846    GGMR01015682    MBY28301.1    ABLF02004526    ABLF02054969    GGMR01016004    MBY28623.1    GEHC01000930    JAV46715.1    ABLF02004401    ABLF02013544    ABLF02013550    IAAA01004058    LAA02042.1    LBMM01011790    KMQ86624.1    IAAA01004056    LAA02037.1    ABLF02033943    ABLF02042737    GBBI01004551    JAC14161.1    GBBI01004550    JAC14162.1    GBXI01004632    JAD09660.1    GAMC01007326    JAB99229.1    KQ971339    KYB27733.1    IAAA01004057    LAA02040.1    GBBI01004477    JAC14235.1    ABLF02003120    ABLF02004015    ABLF02057179    ABLF02066208    ABLF02017401    GBXI01015151    JAC99140.1    NWSH01002797    PCG67520.1    GAMC01002791    JAC03765.1    GAKP01001563    JAC57389.1    GAMC01020207    JAB86348.1    GEZM01010479    JAV94032.1    ABLF02014660    ABLF02042774    GAKP01016237    JAC42715.1    GFTR01008753    JAW07673.1    GBXI01005773    JAD08519.1    GAKP01014483    JAC44469.1    GGMR01015939    MBY28558.1    KQ971307    KYB29884.1    GGMR01014623    MBY27242.1    ABLF02008500    GAKP01016235    JAC42717.1    GEHC01000888    JAV46757.1    ABLF02008975    ABLF02042241    GGMR01018805    MBY31424.1    ABLF02005879    ABLF02005881    GAKP01019383    JAC39569.1    GEHC01000880    JAV46765.1    GEHC01000876    JAV46769.1    ABLF02005127    ABLF02005129    ABLF02007401    GGMR01000717    MBY13336.1    GAKP01008942    JAC50010.1    GGMR01011041    MBY23660.1    GFJQ02004121    JAW02849.1    AY050234    AAK84933.1    KP706795    AKD28027.1    GGFL01001689    MBW65867.1    X95908    CAA65152.1    GBBI01004549    JAC14163.1   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00077   RVP
PF00665   rve
PF17917   RT_RNaseH
PF00098   zf-CCHC
PF14392   zf-CCHC_4
PF13873   Myb_DNA-bind_5
PF02037   SAP
PF09668   Asp_protease
PF03732   Retrotrans_gag
PF16064   DUF4806
PF12384   Peptidase_A2B
Interpro
IPR001969   Aspartic_peptidase_AS        + More
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR001995   Peptidase_A2_cat       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR018061   Retropepsins       
IPR036397   RNaseH_sf       
IPR041373   RT_RNaseH       
IPR036875   Znf_CCHC_sf       
IPR025836   Zn_knuckle_CX2CX4HX4C       
IPR034122   Retropepsin-like_bacterial       
IPR028002   Myb_DNA-bind_5       
IPR036361   SAP_dom_sf       
IPR003034   SAP_dom       
IPR019103   Peptidase_aspartic_DDI1-type       
IPR005162   Retrotrans_gag_dom       
IPR032071   DUF4806       
IPR024650   Peptidase_A2B       
IPR034145   RP_RTVL-H-like       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
SSF68906   SSF68906       
Gene 3D
PDB
4OL8     E-value=9.37866e-29,     Score=319

Ontologies

Topology

Length:
802
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01579
Exp number, first 60 AAs:
0.0003
Total prob of N-in:
0.00014
outside
1  -  802
 
 

Population Genetic Test Statistics

Pi
1.492502
Theta
133.530008
Tajima's D
-0.601025
CLR
166.827001
CSRT
0.217789110544473
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号